Regulon of MerR in Ralstonia metallidurans CH34

Properties
Regulator type:	Transcription factor
TF locus tag:	Rmet_2312, Rmet_6344, pMOL30_054, Rmet_5990, pMOL30_108, RMe0108, Rmet_6171
Regulator family:	MerR
Regulation mode:	activator
Biological process:	Mercury resistance
Effector:	Mercury ion, (Hg2+)
Regulog:	MerR - Ralstonia
Statistics of regulated genes:
- Genes	25
- Operons	7
Visualization:
	Allows to visualize regulon content in the context of metabolic pathways

Built upon 11 sites [see more]

Member of regulog collections

By taxonomy - Ralstonia
By trascription factor - MerR
By TF family - MerR
By effector - Mercury ion, (Hg2+)
By pathway - Mercury resistance

Regulated operons
	Locus Tag	Name	Function
Position: -62 Score: 6.3 Sequence: ACTCCGTACTCAGGTACGGGAT Locus tag: pMOL30_053 Name: merT Funciton: Mercuric transport protein, MerT Locus tag: pMOL30_052 Name: merP Funciton: Periplasmic mercury (+2) binding protein
	pMOL30_053	merT	Mercuric transport protein, MerT
	pMOL30_052	merP	Periplasmic mercury (+2) binding protein
Position: -62 Score: 6.3 Sequence: ACTCCGTACTCAGGTACGGGAT Locus tag: Rmet_5991 Name: merT Funciton: Mercuric transport protein, MerT
	Rmet_5991	merT	Mercuric transport protein, MerT
Position: -63 Score: 6.2 Sequence: ACTCCGTAGTTGACTACGGAAG Locus tag: Rmet_2313 Name: null Funciton: Mercuric transport protein, MerT Locus tag: Rmet_2314 Name: merP Funciton: Periplasmic mercury (+2) binding protein
	Rmet_2313		Mercuric transport protein, MerT
	Rmet_2314	merP	Periplasmic mercury (+2) binding protein
Position: -63 Score: 6.3 Sequence: ACTCCGTACATGAGTACGGAAG Locus tag: RMe0107 Name: merT Funciton: Mercury uptake inner membane protein Locus tag: RMe0106 Name: merP Funciton: Periplasmic mercury (+2) binding protein Locus tag: RMe0105 Name: merA Funciton: Mercuric ion reductase (EC 1.16.1.1) Locus tag: RMe0104 Name: merD Funciton: Mercuric resistance operon coregulator Locus tag: RMe0103 Name: merE Funciton: Putative mercury resistance protein
	RMe0107	merT	Mercury uptake inner membane protein
	RMe0106	merP	Periplasmic mercury (+2) binding protein
	RMe0105	merA	Mercuric ion reductase (EC 1.16.1.1)
	RMe0104	merD	Mercuric resistance operon coregulator
	RMe0103	merE	Putative mercury resistance protein
Position: -63 Score: 6.3 Sequence: ACTCCGTACATGAGTACGGAAG Locus tag: pMOL30_107 Name: merT Funciton: Mercury uptake inner membane protein Locus tag: pMOL30_106 Name: merP Funciton: Periplasmic mercury (+2) binding protein Locus tag: pMOL30_105 Name: merA Funciton: Mercuric ion reductase (EC 1.16.1.1) Locus tag: pMOL30_104 Name: merD Funciton: Mercuric resistance operon coregulator Locus tag: pMOL30_103 Name: merE Funciton: Putative mercury resistance protein
	pMOL30_107	merT	Mercury uptake inner membane protein
	pMOL30_106	merP	Periplasmic mercury (+2) binding protein
	pMOL30_105	merA	Mercuric ion reductase (EC 1.16.1.1)
	pMOL30_104	merD	Mercuric resistance operon coregulator
	pMOL30_103	merE	Putative mercury resistance protein
Position: -63 Score: 6.3 Sequence: ACTCCGTACATGAGTACGGAAG Locus tag: Rmet_6172 Name: merT Funciton: Mercury uptake inner membane protein Locus tag: Rmet_6173 Name: merP Funciton: Periplasmic mercury (+2) binding protein Locus tag: Rmet_6174 Name: merA Funciton: Mercuric ion reductase (EC 1.16.1.1) Locus tag: Rmet_6175 Name: merD Funciton: Mercuric resistance operon coregulator Locus tag: Rmet_6176 Name: merE Funciton: Putative mercury resistance protein
	Rmet_6172	merT	Mercury uptake inner membane protein
	Rmet_6173	merP	Periplasmic mercury (+2) binding protein
	Rmet_6174	merA	Mercuric ion reductase (EC 1.16.1.1)
	Rmet_6175	merD	Mercuric resistance operon coregulator
	Rmet_6176	merE	Putative mercury resistance protein
Position: -63 Score: 6.3 Sequence: ACTCCGTACATGAGTACGGAAG Locus tag: Rmet_6345 Name: merT Funciton: Mercury uptake inner membane protein Locus tag: Rmet_6346 Name: merP Funciton: Periplasmic mercury (+2) binding protein Locus tag: Rmet_6183 Name: merA Funciton: Mercuric ion reductase (EC 1.16.1.1) Locus tag: Rmet_6184 Name: merD Funciton: Mercuric resistance operon coregulator Locus tag: Rmet_6185 Name: merE Funciton: Putative mercury resistance protein
	Rmet_6345	merT	Mercury uptake inner membane protein
	Rmet_6346	merP	Periplasmic mercury (+2) binding protein
	Rmet_6183	merA	Mercuric ion reductase (EC 1.16.1.1)
	Rmet_6184	merD	Mercuric resistance operon coregulator
	Rmet_6185	merE	Putative mercury resistance protein

Export
	Regulated Genes	[ Tab delimited format ]	DOWNLOAD
	Regulatory Sites	[ FASTA format ]	DOWNLOAD

Collection of Manually Curated Inferences of Regulons in Prokaryotic Genomes -- version 3.2 --

Regulon of MerR in Ralstonia metallidurans CH34

Collection of Manually Curated Inferences of Regulons in Prokaryotic Genomes
-- version 3.2 --