Regulon of MerR in Shewanella sp ANA-3

Properties
Regulator type:	Transcription factor
TF locus tag:	Shewana3_4341, Shewana3_4315
Regulator family:	MerR
Regulation mode:	activator
Biological process:	Mercury resistance
Effector:	Mercury ion, (Hg2+)
Regulog:	MerR - Shewanellaceae
Statistics of regulated genes:
- Genes	12
- Operons	2
Visualization:
	Allows to visualize regulon content in the context of metabolic pathways

Built upon 5 sites [see more]

Member of regulog collections

By taxonomy - Shewanellaceae
By trascription factor - MerR
By TF family - MerR
By effector - Mercury ion, (Hg2+)
By pathway - Mercury resistance

Regulated operons
	Locus Tag	Name	Function
Position: -61 Score: 6.1 Sequence: ACTCCGTACATCGGTACGGAGA Locus tag: Shewana3_4314 Name: merT Funciton: Mercury uptake inner membane protein Locus tag: Shewana3_4313 Name: merP Funciton: Periplasmic mercury(+2) binding protein Locus tag: Shewana3_4312 Name: merC Funciton: Mercury uptake inner membane protein Locus tag: Shewana3_4311 Name: merA Funciton: Mercuric ion reductase (EC 1.16.1.1) Locus tag: Shewana3_4310 Name: PF00563 Funciton: diguanylate cyclase/phosphodiesterase (GGDEF & EAL domains) with PAS/PAC sensor(s) Locus tag: Shewana3_4309 Name: merD Funciton: Mercuric resistance operon coregulator
	Shewana3_4314	merT	Mercury uptake inner membane protein
	Shewana3_4313	merP	Periplasmic mercury(+2) binding protein
	Shewana3_4312	merC	Mercury uptake inner membane protein
	Shewana3_4311	merA	Mercuric ion reductase (EC 1.16.1.1)
	Shewana3_4310	PF00563	diguanylate cyclase/phosphodiesterase (GGDEF & EAL domains) with PAS/PAC sensor(s)
	Shewana3_4309	merD	Mercuric resistance operon coregulator
Position: -63 Score: 6.3 Sequence: ACTCCGTACATAACTACGGAAG Locus tag: Shewana3_4342 Name: merT2 Funciton: Mercury uptake inner membane protein Locus tag: Shewana3_4343 Name: merP2 Funciton: Periplasmic mercury (+2) binding protein Locus tag: Shewana3_4344 Name: merC2 Funciton: Mercury uptake inner membane protein Locus tag: Shewana3_4345 Name: merA2 Funciton: Mercuric ion reductase (EC 1.16.1.1) Locus tag: Shewana3_4346 Name: merD2 Funciton: Mercuric resistance operon coregulator Locus tag: Shewana3_4347 Name: merE2 Funciton: Putative mercury resistance protein
	Shewana3_4342	merT2	Mercury uptake inner membane protein
	Shewana3_4343	merP2	Periplasmic mercury (+2) binding protein
	Shewana3_4344	merC2	Mercury uptake inner membane protein
	Shewana3_4345	merA2	Mercuric ion reductase (EC 1.16.1.1)
	Shewana3_4346	merD2	Mercuric resistance operon coregulator
	Shewana3_4347	merE2	Putative mercury resistance protein

Export
	Regulated Genes	[ Tab delimited format ]	DOWNLOAD
	Regulatory Sites	[ FASTA format ]	DOWNLOAD