Regulog MerR - Shewanellaceae
| Regulator type: | Transcription factor |
| Regulator family: | MerR |
| Regulation mode: | activator |
| Biological process: | Mercury resistance |
| Effector: | Mercury ion, (Hg2+) |
| Phylum: | Proteobacteria/Gamma |
| Visualization: | |
|
Allows to visualize regulog content in the context of metabolic pathways |
Member of regulog collections
- By taxonomy - Shewanellaceae
- By trascription factor - MerR
- By TF family - MerR
- By effector - Mercury ion, (Hg2+)
- By pathway - Mercury resistance
| Genome | Genes | Operons |
|---|---|---|
| Shewanella oneidensis MR-1 | ||
| Shewanella putrefaciens CN-32 | 3 | 1 |
| Shewanella sp W3-18-1 | 3 | 1 |
| Shewanella sp ANA-3 | 12 | 2 |
| Shewanella sp MR-4 | ||
| Shewanella sp MR-7 | ||
| Shewanella baltica OS155 | ||
| Shewanella denitrificans OS217 | ||
| Shewanella frigidimarina NCIMB 400 | 4 | 1 |
| Shewanella amazonensis SB2B | ||
| Shewanella loihica PV-4 | ||
| Shewanella pealeana ATCC 700345 | ||
| Shewanella halifaxensis HAW-EB4 | ||
| Shewanella piezotolerans WP3 | ||
| Shewanella sediminis HAW-EB3 | ||
| Shewanella woodyi ATCC 51908 |
| Genes | Function | ||||||||||||||||
|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|
| CRON 1. | |||||||||||||||||
| merT |
|
*
Shewanella putrefaciens CN-32 Site: position = -61 score = 6.22411 sequence = ACTCCGTACTATGGTACGGCAT Gene: Sputcn32_0170: Mercury uptake inner membane protein |
*
Shewanella sp W3-18-1 Site: position = -61 score = 6.22411 sequence = ACTCCGTACTATGGTACGGCAT Gene: Sputw3181_3206: Mercury uptake inner membane protein |
*
Shewanella sp ANA-3 Site: position = -61 score = 6.0836 sequence = ACTCCGTACATCGGTACGGAGA Gene: Shewana3_4314: Mercury uptake inner membane protein |
|
|
|
|
*
Shewanella frigidimarina NCIMB 400 Site: position = -61 score = 5.97783 sequence = ACTCCGTACATAGGTACGGCAC Gene: Sfri_3491: Mercury uptake inner membane protein |
|
|
|
|
|
|
|
Mercury uptake inner membane protein |
| merP |
|
Gene: Sputcn32_0169: Periplasmic mercury(+2) binding protein |
Gene: Sputw3181_3207: Periplasmic mercury(+2) binding protein |
Gene: Shewana3_4313: Periplasmic mercury(+2) binding protein |
|
|
|
|
Gene: Sfri_3490: Periplasmic mercury(+2) binding protein |
|
|
|
|
|
|
|
Periplasmic mercury(+2) binding protein |
| merC |
|
|
|
Gene: Shewana3_4312: Mercury uptake inner membane protein |
|
|
|
|
Gene: Sfri_3489: Mercury uptake inner membane protein |
|
|
|
|
|
|
|
Mercury uptake inner membane protein |
| merA |
|
Gene: Sputcn32_0168: Mercuric ion reductase (EC 1.16.1.1) |
Gene: Sputw3181_3208: Mercuric ion reductase (EC 1.16.1.1) |
Gene: Shewana3_4311: Mercuric ion reductase (EC 1.16.1.1) |
|
|
|
|
Gene: Sfri_3488: Mercuric ion reductase (EC 1.16.1.1) |
|
|
|
|
|
|
|
Mercuric ion reductase (EC 1.16.1.1) |
| PF00563 |
|
|
|
Gene: Shewana3_4310: diguanylate cyclase/phosphodiesterase (GGDEF & EAL domains) with PAS/PAC sensor(s) |
|
|
|
|
|
|
|
|
|
|
|
|
diguanylate cyclase/phosphodiesterase (GGDEF & EAL domains) with PAS/PAC sensor(s) |
| merD |
|
|
|
Gene: Shewana3_4309: Mercuric resistance operon coregulator |
|
|
|
|
|
|
|
|
|
|
|
|
Mercuric resistance operon coregulator |
| CRON 2. | |||||||||||||||||
| merT2 |
|
|
|
*
Shewanella sp ANA-3 Site: position = -63 score = 6.32981 sequence = ACTCCGTACATAACTACGGAAG Gene: Shewana3_4342: Mercury uptake inner membane protein |
|
|
|
|
|
|
|
|
|
|
|
|
Mercury uptake inner membane protein |
| merP2 |
|
|
|
Gene: Shewana3_4343: Periplasmic mercury (+2) binding protein |
|
|
|
|
|
|
|
|
|
|
|
|
Periplasmic mercury (+2) binding protein |
| merC2 |
|
|
|
Gene: Shewana3_4344: Mercury uptake inner membane protein |
|
|
|
|
|
|
|
|
|
|
|
|
Mercury uptake inner membane protein |
| merA2 |
|
|
|
Gene: Shewana3_4345: Mercuric ion reductase (EC 1.16.1.1) |
|
|
|
|
|
|
|
|
|
|
|
|
Mercuric ion reductase (EC 1.16.1.1) |
| merD2 |
|
|
|
Gene: Shewana3_4346: Mercuric resistance operon coregulator |
|
|
|
|
|
|
|
|
|
|
|
|
Mercuric resistance operon coregulator |
| merE2 |
|
|
|
Gene: Shewana3_4347: Putative mercury resistance protein |
|
|
|
|
|
|
|
|
|
|
|
|
Putative mercury resistance protein |
Bluish color - the gene is in regulated operon. Different regulated operons are shown in different shades of blue.
Red color - the gene is in non-regulated operon.
Gray color - the orthologous gene is absent.
The star symbol - the TFBS is located in upstream region of this gene.
The number - the numeber of homologs (shown only if it is greater than one).
|
Regulated Genes | [ Tab delimited format ] | DOWNLOAD |
|
Regulatory Sites | [ FASTA format ] | DOWNLOAD |