Regulon of CueR in Stenotrophomonas maltophilia K279a

Properties
Regulator type:	Transcription factor
TF locus tag:	Smlt2177
Regulator family:	MerR
Regulation mode:	activator
Biological process:	Copper resistance
Effector:	Copper ion, (Cu+)
Regulog:	CueR - Xanthomonadales
Statistics of regulated genes:
- Genes	3
- Operons	2
Visualization:
	Allows to visualize regulon content in the context of metabolic pathways

Built upon 2 sites [see more]

Member of regulog collections

By taxonomy - Xanthomonadales
By trascription factor - CueR
By TF family - MerR
By effector - Copper ion, (Cu+)
By pathway - Copper resistance

Regulated operons
	Locus Tag	Name	Function
Position: -62 Score: 6.1 Sequence: ACCTTCCCACGATGGCAAGGT Locus tag: Smlt2176 Name: copA Funciton: Copper-translocating P-type ATPase (EC 3.6.3.4) Locus tag: Smlt2177 Name: cueR Funciton: Copper resistance ranscriptional regulator, MerR family
	Smlt2176	copA	Copper-translocating P-type ATPase (EC 3.6.3.4)
	Smlt2177	cueR	Copper resistance ranscriptional regulator, MerR family
Position: -61 Score: 5.6 Sequence: ACCCTGCCATCGTTGGAAGGT Locus tag: Smlt2178 Name: copZ Funciton: Copper chaperone
	Smlt2178	copZ	Copper chaperone

Export
	Regulated Genes	[ Tab delimited format ]	DOWNLOAD
	Regulatory Sites	[ FASTA format ]	DOWNLOAD