Profile of regulator CueR in Xanthomonadales
| Regulator family: | MerR |
| Regulation mode: | activator |
| Biological process: | Copper resistance |
| Effector: | Copper ion, (Cu+) |
| Regulog: | CueR - Xanthomonadales |
Member of regulog collections
- By taxonomy - Xanthomonadales
- By trascription factor - CueR
- By TF family - MerR
- By effector - Copper ion, (Cu+)
- By pathway - Copper resistance
Transcription factor binding sites
| Locus Tag | Name | Position | Score | Sequence | |
|---|---|---|---|---|---|
| Stenotrophomonas maltophilia K279a | |||||
| Smlt2178 | copZ | -61 | 5.6 | ACCCTGCCATCGTTGGAAGGT | |
| Smlt2176 | copA | -62 | 6.1 | ACCTTCCCACGATGGCAAGGT | |
|
Regulatory Sites | [ FASTA format ] | DOWNLOAD |