Regulog CueR - Xanthomonadales

Member of regulog collections
- By taxonomy - Xanthomonadales
- By trascription factor - CueR
- By TF family - MerR
- By effector - Copper ion, (Cu+)
- By pathway - Copper resistance
Genome | Genes | Operons |
---|---|---|
Xylella fastidiosa 9a5c | ||
Xanthomonas axonopodis pv. citri str. 306 | ||
Xanthomonas campestris pv. campestris str. ATCC 33913 | ||
Stenotrophomonas maltophilia K279a | 3 | 2 |
Genes | Function | ||||
---|---|---|---|---|---|
CRON 1. | |||||
copZ |
|
|
|
*
Stenotrophomonas maltophilia K279a Site: position = -61 score = 5.62417 sequence = ACCCTGCCATCGTTGGAAGGT Gene: Smlt2178: Copper chaperone |
Copper chaperone |
CRON 2. | |||||
copA |
|
|
|
*
Stenotrophomonas maltophilia K279a Site: position = -62 score = 6.09972 sequence = ACCTTCCCACGATGGCAAGGT Gene: Smlt2176: Copper-translocating P-type ATPase (EC 3.6.3.4) |
Copper-translocating P-type ATPase (EC 3.6.3.4) |
cueR |
|
|
|
Gene: Smlt2177: Copper resistance ranscriptional regulator, MerR family |
Copper resistance ranscriptional regulator, MerR family |
Bluish color - the gene is in regulated operon. Different regulated operons are shown in different shades of blue.
Red color - the gene is in non-regulated operon.
Gray color - the orthologous gene is absent.
The star symbol - the TFBS is located in upstream region of this gene.
The number - the numeber of homologs (shown only if it is greater than one).
![]() |
Regulated Genes | [ Tab delimited format ] | DOWNLOAD |
![]() |
Regulatory Sites | [ FASTA format ] | DOWNLOAD |