Regulog CueR - Xanthomonadales

Properties
Regulator type:	Transcription factor
Regulator family:	MerR
Regulation mode:	activator
Biological process:	Copper resistance
Effector:	Copper ion, (Cu+)
Phylum:	Proteobacteria/gamma
Visualization:
	Allows to visualize regulog content in the context of metabolic pathways

Built upon 2 sites [see more]

Member of regulog collections

Statistics of regulated genes
Genome	Genes	Operons
Xylella fastidiosa 9a5c
Xanthomonas axonopodis pv. citri str. 306
Xanthomonas campestris pv. campestris str. ATCC 33913
Stenotrophomonas maltophilia K279a	3	2

Clusters of co-Regulated Orthologous operoNs (CRONs)
Genes					Function

CRON 1.
copZ	Xylella fastidiosa 9a5c	Xanthomonas axonopodis pv. citri str. 306	Xanthomonas campestris pv. campestris str. ATCC 33913	* Stenotrophomonas maltophilia K279a Site: position = -61 score = 5.62417 sequence = ACCCTGCCATCGTTGGAAGGT Gene: Smlt2178: Copper chaperone	Copper chaperone

CRON 2.
copA	Xylella fastidiosa 9a5c	Xanthomonas axonopodis pv. citri str. 306	Xanthomonas campestris pv. campestris str. ATCC 33913	* Stenotrophomonas maltophilia K279a Site: position = -62 score = 6.09972 sequence = ACCTTCCCACGATGGCAAGGT Gene: Smlt2176: Copper-translocating P-type ATPase (EC 3.6.3.4)	Copper-translocating P-type ATPase (EC 3.6.3.4)
cueR	Xylella fastidiosa 9a5c	Xanthomonas axonopodis pv. citri str. 306	Xanthomonas campestris pv. campestris str. ATCC 33913	Stenotrophomonas maltophilia K279a Gene: Smlt2177: Copper resistance ranscriptional regulator, MerR family	Copper resistance ranscriptional regulator, MerR family

Bluish color - the gene is in regulated operon. Different regulated operons are shown in different shades of blue.

Red color - the gene is in non-regulated operon.

Gray color - the orthologous gene is absent.

The star symbol - the TFBS is located in upstream region of this gene.

The number - the numeber of homologs (shown only if it is greater than one).

Export
	Regulated Genes	[ Tab delimited format ]	DOWNLOAD
	Regulatory Sites	[ FASTA format ]	DOWNLOAD

Collection of Manually Curated Inferences of Regulons in Prokaryotic Genomes -- version 3.2 --