Regulon of SoxR in Acinetobacter sp. ADP1

Properties
Regulator type:	Transcription factor
TF locus tag:	ACIAD3082
Regulator family:	MerR
Regulation mode:	activator (repressor)
Biological process:	Superoxide stress response
Effector:	Paraquat
Regulog:	SoxR - Moraxellaceae
Statistics of regulated genes:
- Genes	2
- Operons	1
Visualization:
	Allows to visualize regulon content in the context of metabolic pathways

Built upon 2 sites [see more]

Member of regulog collections

By taxonomy - Moraxellaceae
By trascription factor - SoxR
By TF family - MerR
By effector - Paraquat
By pathway - Superoxide stress response

Regulated operons
	Locus Tag	Name	Function
Position: -13 Score: 6.5 Sequence: ACCTCAAGTTAACTTGAGCT Locus tag: ACIAD3083 Name: PF01042 Funciton: Endoribonuclease L-PSP Locus tag: ACIAD3084 Name: PF07690 Funciton: Permease of the major facilitator superfamily
	ACIAD3083	PF01042	Endoribonuclease L-PSP
	ACIAD3084	PF07690	Permease of the major facilitator superfamily

Export
	Regulated Genes	[ Tab delimited format ]	DOWNLOAD
	Regulatory Sites	[ FASTA format ]	DOWNLOAD