Regulon of SoxR in Acinetobacter sp. ADP1
| Regulator type: | Transcription factor |
| TF locus tag: | ACIAD3082 |
| Regulator family: | MerR |
| Regulation mode: | activator (repressor) |
| Biological process: | Superoxide stress response |
| Effector: | Paraquat |
| Regulog: | SoxR - Moraxellaceae |
| Statistics of regulated genes: | |
| - Genes | 2 |
| - Operons | 1 |
| Visualization: | |
|
Allows to visualize regulon content in the context of metabolic pathways |
Member of regulog collections
- By taxonomy - Moraxellaceae
- By trascription factor - SoxR
- By TF family - MerR
- By effector - Paraquat
- By pathway - Superoxide stress response
| Locus Tag | Name | Function | |
|---|---|---|---|
|
Position: -13
Score: 6.5 Sequence: ACCTCAAGTTAACTTGAGCT
Locus tag: ACIAD3083
Name: PF01042 Funciton: Endoribonuclease L-PSP
Locus tag: ACIAD3084
Name: PF07690 Funciton: Permease of the major facilitator superfamily |
|||
|
PF01042
|
Endoribonuclease L-PSP
|
||
|
PF07690
|
Permease of the major facilitator superfamily
|
||
|
Regulated Genes | [ Tab delimited format ] | DOWNLOAD |
|
Regulatory Sites | [ FASTA format ] | DOWNLOAD |