Regulog SoxR - Moraxellaceae

Properties
Regulator type:	Transcription factor
Regulator family:	MerR
Regulation mode:	activator (repressor)
Biological process:	Superoxide stress response
Effector:	Paraquat
Phylum:	Proteobacteria/gamma
Visualization:
	Allows to visualize regulog content in the context of metabolic pathways

Built upon 2 sites [see more]

Member of regulog collections

Clusters of co-Regulated Orthologous operoNs (CRONs)
Genes					Function

CRON 1.
PF01042	* Acinetobacter sp. ADP1 Site: position = -13 score = 6.45899 sequence = ACCTCAAGTTAACTTGAGCT Gene: ACIAD3083: Endoribonuclease L-PSP	* Acinetobacter baumannii AB0057 Site: position = -58 score = 6.84804 sequence = ACCTCAACTTAAGTTGAGGT Gene: AB57_0668: Endoribonuclease L-PSP	Psychrobacter arcticum 273-4	Psychrobacter sp. PRwf-1	Endoribonuclease L-PSP
PF07690	Acinetobacter sp. ADP1 Gene: ACIAD3084: Permease of the major facilitator superfamily	Acinetobacter baumannii AB0057 Gene: AB57_0667: Permease of the major facilitator superfamily	Psychrobacter arcticum 273-4	Psychrobacter sp. PRwf-1	Permease of the major facilitator superfamily

Bluish color - the gene is in regulated operon. Different regulated operons are shown in different shades of blue.

Red color - the gene is in non-regulated operon.

Gray color - the orthologous gene is absent.

The star symbol - the TFBS is located in upstream region of this gene.

The number - the numeber of homologs (shown only if it is greater than one).

Export
	Regulated Genes	[ Tab delimited format ]	DOWNLOAD
	Regulatory Sites	[ FASTA format ]	DOWNLOAD

Collection of Manually Curated Inferences of Regulons in Prokaryotic Genomes -- version 3.2 --