Regulon of SoxR in Reinekea sp. MED297
| Regulator type: | Transcription factor |
| TF locus tag: | MED297_19447 |
| Regulator family: | MerR |
| Regulation mode: | activator (repressor) |
| Biological process: | Superoxide stress response |
| Effector: | Paraquat |
| Regulog: | SoxR - Oceanospirillales/Alteromonadales |
| Statistics of regulated genes: | |
| - Genes | 1 |
| - Operons | 1 |
| Visualization: | |
|
Allows to visualize regulon content in the context of metabolic pathways |
Member of regulog collections
- By taxonomy - Oceanospirillales/Alteromonadales
- By trascription factor - SoxR
- By TF family - MerR
- By effector - Paraquat
- By pathway - Superoxide stress response
| Locus Tag | Name | Function | |
|---|---|---|---|
|
Position: -61
Score: 6.7 Sequence: ACCTCAACTTTAGTTGAGGT
Locus tag: MED297_19452
Name: PF00903 Funciton: Glyoxalase/bleomycin resistance protein/dioxygenase |
|||
|
PF00903
|
Glyoxalase/bleomycin resistance protein/dioxygenase
|
||
|
Regulated Genes | [ Tab delimited format ] | DOWNLOAD |
|
Regulatory Sites | [ FASTA format ] | DOWNLOAD |