Regulog SoxR - Oceanospirillales/Alteromonadales
| Regulator type: | Transcription factor |
| Regulator family: | MerR |
| Regulation mode: | activator (repressor) |
| Biological process: | Superoxide stress response |
| Effector: | Paraquat |
| Phylum: | Proteobacteria/gamma |
| Visualization: | |
|
Allows to visualize regulog content in the context of metabolic pathways |
Member of regulog collections
- By taxonomy - Oceanospirillales/Alteromonadales
- By trascription factor - SoxR
- By TF family - MerR
- By effector - Paraquat
- By pathway - Superoxide stress response
| Genome | Genes | Operons |
|---|---|---|
| Hahella chejuensis KCTC 2396 | 1 | 1 |
| Marinobacter aqueolei | ||
| Marinobacter sp. ELB17 | ||
| Oceanobacter sp. RED65 | ||
| Oceanospirillum sp. MED92 | ||
| Marinomonas sp. MWYL1 | 1 | 1 |
| Saccharophagus degradans 2-40 | ||
| Teredinibacter turnerae T7901 | ||
| Cellvibrio japonicus Ueda107 | ||
| Chromohalobacter salexigens DSM 3043 | ||
| Reinekea sp. MED297 | 1 | 1 |
| Alcanivorax borkumensis SK2 |
| Genes | Function | ||||||||||||
|---|---|---|---|---|---|---|---|---|---|---|---|---|---|
| CRON 1. | |||||||||||||
| PF07690 |
|
|
|
|
|
*
Marinomonas sp. MWYL1 Site: position = -122 score = 6.31209 sequence = ACCTCAACTTAAGTTCAGGT Gene: Mmwyl1_1994: Permease of the major facilitator superfamily |
|
|
|
|
|
|
Permease of the major facilitator superfamily |
| CRON 2. | |||||||||||||
| PF03358 |
*
Hahella chejuensis KCTC 2396 Site: position = -67 score = 6.49684 sequence = ACCTAAAGTTAAGTTGAGGT Gene: HCH_01442: NADPH-dependent FMN reductase |
|
|
|
|
|
|
|
|
|
|
|
NADPH-dependent FMN reductase |
| CRON 3. | |||||||||||||
| PF00903 |
|
|
|
|
|
|
|
|
|
|
*
Reinekea sp. MED297 Site: position = -61 score = 6.67734 sequence = ACCTCAACTTTAGTTGAGGT Gene: MED297_19452: Glyoxalase/bleomycin resistance protein/dioxygenase |
|
Glyoxalase/bleomycin resistance protein/dioxygenase |
Bluish color - the gene is in regulated operon. Different regulated operons are shown in different shades of blue.
Red color - the gene is in non-regulated operon.
Gray color - the orthologous gene is absent.
The star symbol - the TFBS is located in upstream region of this gene.
The number - the numeber of homologs (shown only if it is greater than one).
|
Regulated Genes | [ Tab delimited format ] | DOWNLOAD |
|
Regulatory Sites | [ FASTA format ] | DOWNLOAD |