Regulon of PsiR in Sinorhizobium meliloti 1021

Properties
Regulator type:	Transcription factor
TF locus tag:	SMb20483
Regulator family:	LacI
Regulation mode:
Biological process:	Psicose utilization
Effector:	Psicose
Regulog:	PsiR - Rhizobiales
Statistics of regulated genes:
- Genes	8
- Operons	2
Visualization:
	Allows to visualize regulon content in the context of metabolic pathways

Built upon 16 sites [see more]

Member of regulog collections

By taxonomy - Rhizobiales
By TF family - LacI
By effector - Psicose
By pathway - Psicose utilization

Regulated operons
	Locus Tag	Name	Function
Position: -173 Score: 6.6 Sequence: TTGCACCATCGATTGTGCAA Position: -151 Score: 5.4 Sequence: AAGAAATATCGATTGTGCAA Locus tag: SMb20484 Name: psiA Funciton: Predicted psicose ABC transporter, substrate-binding protein Locus tag: SMb20485 Name: psiB Funciton: Predicted psicose ABC transporter, ATP-binding protein Locus tag: SMb20486 Name: psiC Funciton: Predicted psicose ABC transporter, inner membrane protein Locus tag: SMb20487 Name: psiD Funciton: Predicted psicose ABC transporter, inner membrane protein Locus tag: SMb20488 Name: psiE Funciton: Fructose:psicose-3-epimerase (EC 5.3.1.-) Locus tag: SMb20489 Name: psiK Funciton: Predicted fructokinase, FGGY family Locus tag: SMb20490 Name: fucA2 Funciton: Ribulose-5-phosphate 4-epimerase and related epimerases and aldolases
	SMb20484	psiA	Predicted psicose ABC transporter, substrate-binding protein
	SMb20485	psiB	Predicted psicose ABC transporter, ATP-binding protein
	SMb20486	psiC	Predicted psicose ABC transporter, inner membrane protein
	SMb20487	psiD	Predicted psicose ABC transporter, inner membrane protein
	SMb20488	psiE	Fructose:psicose-3-epimerase (EC 5.3.1.-)
	SMb20489	psiK	Predicted fructokinase, FGGY family
	SMb20490	fucA2	Ribulose-5-phosphate 4-epimerase and related epimerases and aldolases
Position: -142 Score: 5.4 Sequence: TTGCACAATCGATATTTCTT Position: -120 Score: 6.6 Sequence: TTGCACAATCGATGGTGCAA Locus tag: SMb20483 Name: psiR Funciton: Predicted transcriptional regulator for psicose utilization, LacI family
	SMb20483	psiR	Predicted transcriptional regulator for psicose utilization, LacI family

Export
	Regulated Genes	[ Tab delimited format ]	DOWNLOAD
	Regulatory Sites	[ FASTA format ]	DOWNLOAD