Regulon of SocR in Rhodobacter sphaeroides 2.4.1

Properties
Regulator type:	Transcription factor
TF locus tag:	RSP_3939
Regulator family:	LacI
Regulation mode:	repressor
Biological process:	Santhopine utilization
Effector:
Regulog:	SocR - Rhodobacterales
Statistics of regulated genes:
- Genes	8
- Operons	1
Visualization:
	Allows to visualize regulon content in the context of metabolic pathways

Built upon 1 sites [see more]

Member of regulog collections

By taxonomy - Rhodobacterales
By TF family - LacI
By pathway - Santhopine utilization

Regulated operons
	Locus Tag	Name	Function
Position: -72 Score: 5.7 Sequence: GTATGAGATCGGTCTCTCAG Locus tag: RSP_3940 Name: socL Funciton: Fructosyl-amino acid phosphate deglycase (EC 3.5.-.-) Locus tag: RSP_3941 Name: socO Funciton: Opine ABC transporter, substrate-binding protein Locus tag: RSP_3942 Name: socN Funciton: Opine ABC transporter, inner membrane protein Locus tag: RSP_3943 Name: socM Funciton: Opine ABC transporter, substrate-binding protein Locus tag: RSP_3944 Name: socE Funciton: Putative fructosyl-amino acid phosphate epimerase Locus tag: RSP_3945 Name: socK Funciton: Uncharacterized carbohydrate kinase in opine catabolism, PfkB Locus tag: RSP_3946 Name: socD Funciton: Fructosyl-amino acid oxidase (EC 1.5.3.-) Locus tag: RSP_3948 Name: socQ Funciton: Opine ABC transporter, ATP-binding protein
	RSP_3940	socL	Fructosyl-amino acid phosphate deglycase (EC 3.5.-.-)
	RSP_3941	socO	Opine ABC transporter, substrate-binding protein
	RSP_3942	socN	Opine ABC transporter, inner membrane protein
	RSP_3943	socM	Opine ABC transporter, substrate-binding protein
	RSP_3944	socE	Putative fructosyl-amino acid phosphate epimerase
	RSP_3945	socK	Uncharacterized carbohydrate kinase in opine catabolism, PfkB
	RSP_3946	socD	Fructosyl-amino acid oxidase (EC 1.5.3.-)
	RSP_3948	socQ	Opine ABC transporter, ATP-binding protein

Export
	Regulated Genes	[ Tab delimited format ]	DOWNLOAD
	Regulatory Sites	[ FASTA format ]	DOWNLOAD