Regulog SocR - Rhodobacterales
| Regulator type: | Transcription factor |
| Regulator family: | LacI |
| Regulation mode: | repressor |
| Biological process: | Santhopine utilization |
| Effector: | |
| Phylum: | Proteobacteria/Alpha |
| Visualization: | |
|
Allows to visualize regulog content in the context of metabolic pathways |
Member of regulog collections
- By taxonomy - Rhodobacterales
- By TF family - LacI
- By pathway - Santhopine utilization
| Genome | Genes | Operons |
|---|---|---|
| Hyphomonas neptunium ATCC 15444 | ||
| Jannaschia sp. CCS1 | ||
| Loktanella vestfoldensis SKA53 | ||
| Oceanicaulis alexandrii HTCC2633 | ||
| Oceanicola batsensis HTCC2597 | ||
| Oceanicola granulosus HTCC2516 | ||
| Paracoccus denitrificans PD1222 | ||
| Rhodobacter sphaeroides 2.4.1 | 8 | 1 |
| Rhodobacterales bacterium HTCC2654 | ||
| Roseobacter sp. MED193 | ||
| Roseovarius nubinhibens ISM | ||
| Roseovarius sp. 217 | ||
| Silicibacter TM1040 | ||
| Silicibacter pomeroyi DSS-3 | ||
| Sulfitobacter sp. EE-36 |
| Genes | Function | |||||||||||||||
|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|
| CRON 1. | ||||||||||||||||
| socL |
|
|
|
|
|
|
|
*
Rhodobacter sphaeroides 2.4.1 Site: position = -72 score = 5.73012 sequence = GTATGAGATCGGTCTCTCAG Gene: RSP_3940: Fructosyl-amino acid phosphate deglycase (EC 3.5.-.-) |
|
|
|
|
|
|
|
Fructosyl-amino acid phosphate deglycase (EC 3.5.-.-) |
| socO |
|
|
|
|
|
Gene: OG2516_18320: Opine ABC transporter, substrate-binding protein |
|
Gene: RSP_3941: Opine ABC transporter, substrate-binding protein |
|
|
|
|
|
|
|
Opine ABC transporter, substrate-binding protein |
| socN |
|
|
|
|
|
Gene: OG2516_18315: Opine ABC transporter, inner membrane protein |
|
Gene: RSP_3942: Opine ABC transporter, inner membrane protein |
|
|
|
|
|
|
|
Opine ABC transporter, inner membrane protein |
| socM |
|
|
|
|
|
Gene: OG2516_18310: Opine ABC transporter, substrate-binding protein |
|
Gene: RSP_3943: Opine ABC transporter, substrate-binding protein |
|
|
|
|
|
|
|
Opine ABC transporter, substrate-binding protein |
| socE |
|
|
|
|
|
|
|
Gene: RSP_3944: Putative fructosyl-amino acid phosphate epimerase |
|
|
|
|
|
|
|
Putative fructosyl-amino acid phosphate epimerase |
| socK |
|
|
|
|
|
|
|
Gene: RSP_3945: Uncharacterized carbohydrate kinase in opine catabolism, PfkB |
|
|
|
|
|
|
|
Uncharacterized carbohydrate kinase in opine catabolism, PfkB |
| socD |
|
|
|
|
|
|
|
Gene: RSP_3946: Fructosyl-amino acid oxidase (EC 1.5.3.-) |
|
|
|
|
|
|
|
Fructosyl-amino acid oxidase (EC 1.5.3.-) |
| socQ |
|
|
|
|
|
|
|
Gene: RSP_3948: Opine ABC transporter, ATP-binding protein |
|
|
|
|
|
|
|
Opine ABC transporter, ATP-binding protein |
Bluish color - the gene is in regulated operon. Different regulated operons are shown in different shades of blue.
Red color - the gene is in non-regulated operon.
Gray color - the orthologous gene is absent.
The star symbol - the TFBS is located in upstream region of this gene.
The number - the numeber of homologs (shown only if it is greater than one).
|
Regulated Genes | [ Tab delimited format ] | DOWNLOAD |
|
Regulatory Sites | [ FASTA format ] | DOWNLOAD |