Regulog SocR - Rhodobacterales

Properties
Regulator type:	Transcription factor
Regulator family:	LacI
Regulation mode:	repressor
Biological process:	Santhopine utilization
Effector:
Phylum:	Proteobacteria/Alpha
Visualization:
	Allows to visualize regulog content in the context of metabolic pathways

Built upon 1 sites [see more]

Member of regulog collections

By taxonomy - Rhodobacterales
By TF family - LacI
By pathway - Santhopine utilization

Statistics of regulated genes
Genome	Genes	Operons
Hyphomonas neptunium ATCC 15444
Jannaschia sp. CCS1
Loktanella vestfoldensis SKA53
Oceanicaulis alexandrii HTCC2633
Oceanicola batsensis HTCC2597
Oceanicola granulosus HTCC2516
Paracoccus denitrificans PD1222
Rhodobacter sphaeroides 2.4.1	8	1
Rhodobacterales bacterium HTCC2654
Roseobacter sp. MED193
Roseovarius nubinhibens ISM
Roseovarius sp. 217
Silicibacter TM1040
Silicibacter pomeroyi DSS-3
Sulfitobacter sp. EE-36

Clusters of co-Regulated Orthologous operoNs (CRONs)
Genes																Function

CRON 1.
socL	Hyphomonas neptunium ATCC 15444	Jannaschia sp. CCS1	Loktanella vestfoldensis SKA53	Oceanicaulis alexandrii HTCC2633	Oceanicola batsensis HTCC2597	Oceanicola granulosus HTCC2516	Paracoccus denitrificans PD1222	* Rhodobacter sphaeroides 2.4.1 Site: position = -72 score = 5.73012 sequence = GTATGAGATCGGTCTCTCAG Gene: RSP_3940: Fructosyl-amino acid phosphate deglycase (EC 3.5.-.-)	Rhodobacterales bacterium HTCC2654	Roseobacter sp. MED193	Roseovarius nubinhibens ISM	Roseovarius sp. 217	Silicibacter TM1040	Silicibacter pomeroyi DSS-3	Sulfitobacter sp. EE-36	Fructosyl-amino acid phosphate deglycase (EC 3.5.-.-)
socO	Hyphomonas neptunium ATCC 15444	Jannaschia sp. CCS1	Loktanella vestfoldensis SKA53	Oceanicaulis alexandrii HTCC2633	Oceanicola batsensis HTCC2597	Oceanicola granulosus HTCC2516 Gene: OG2516_18320: Opine ABC transporter, substrate-binding protein	Paracoccus denitrificans PD1222	Rhodobacter sphaeroides 2.4.1 Gene: RSP_3941: Opine ABC transporter, substrate-binding protein	Rhodobacterales bacterium HTCC2654	Roseobacter sp. MED193	Roseovarius nubinhibens ISM	Roseovarius sp. 217	Silicibacter TM1040	Silicibacter pomeroyi DSS-3	Sulfitobacter sp. EE-36	Opine ABC transporter, substrate-binding protein
socN	Hyphomonas neptunium ATCC 15444	Jannaschia sp. CCS1	Loktanella vestfoldensis SKA53	Oceanicaulis alexandrii HTCC2633	Oceanicola batsensis HTCC2597	Oceanicola granulosus HTCC2516 Gene: OG2516_18315: Opine ABC transporter, inner membrane protein	Paracoccus denitrificans PD1222	Rhodobacter sphaeroides 2.4.1 Gene: RSP_3942: Opine ABC transporter, inner membrane protein	Rhodobacterales bacterium HTCC2654	Roseobacter sp. MED193	Roseovarius nubinhibens ISM	Roseovarius sp. 217	Silicibacter TM1040	Silicibacter pomeroyi DSS-3	Sulfitobacter sp. EE-36	Opine ABC transporter, inner membrane protein
socM	Hyphomonas neptunium ATCC 15444	Jannaschia sp. CCS1	Loktanella vestfoldensis SKA53	Oceanicaulis alexandrii HTCC2633	Oceanicola batsensis HTCC2597	Oceanicola granulosus HTCC2516 Gene: OG2516_18310: Opine ABC transporter, substrate-binding protein	Paracoccus denitrificans PD1222	Rhodobacter sphaeroides 2.4.1 Gene: RSP_3943: Opine ABC transporter, substrate-binding protein	Rhodobacterales bacterium HTCC2654	Roseobacter sp. MED193	Roseovarius nubinhibens ISM	Roseovarius sp. 217	Silicibacter TM1040	Silicibacter pomeroyi DSS-3	Sulfitobacter sp. EE-36	Opine ABC transporter, substrate-binding protein
socE	Hyphomonas neptunium ATCC 15444	Jannaschia sp. CCS1	Loktanella vestfoldensis SKA53	Oceanicaulis alexandrii HTCC2633	Oceanicola batsensis HTCC2597	Oceanicola granulosus HTCC2516	Paracoccus denitrificans PD1222	Rhodobacter sphaeroides 2.4.1 Gene: RSP_3944: Putative fructosyl-amino acid phosphate epimerase	Rhodobacterales bacterium HTCC2654	Roseobacter sp. MED193	Roseovarius nubinhibens ISM	Roseovarius sp. 217	Silicibacter TM1040	Silicibacter pomeroyi DSS-3	Sulfitobacter sp. EE-36	Putative fructosyl-amino acid phosphate epimerase
socK	Hyphomonas neptunium ATCC 15444	Jannaschia sp. CCS1	Loktanella vestfoldensis SKA53	Oceanicaulis alexandrii HTCC2633	Oceanicola batsensis HTCC2597	Oceanicola granulosus HTCC2516	Paracoccus denitrificans PD1222	Rhodobacter sphaeroides 2.4.1 Gene: RSP_3945: Uncharacterized carbohydrate kinase in opine catabolism, PfkB	Rhodobacterales bacterium HTCC2654	Roseobacter sp. MED193	Roseovarius nubinhibens ISM	Roseovarius sp. 217	Silicibacter TM1040	Silicibacter pomeroyi DSS-3	Sulfitobacter sp. EE-36	Uncharacterized carbohydrate kinase in opine catabolism, PfkB
socD	Hyphomonas neptunium ATCC 15444	Jannaschia sp. CCS1	Loktanella vestfoldensis SKA53	Oceanicaulis alexandrii HTCC2633	Oceanicola batsensis HTCC2597	Oceanicola granulosus HTCC2516	Paracoccus denitrificans PD1222	Rhodobacter sphaeroides 2.4.1 Gene: RSP_3946: Fructosyl-amino acid oxidase (EC 1.5.3.-)	Rhodobacterales bacterium HTCC2654	Roseobacter sp. MED193	Roseovarius nubinhibens ISM	Roseovarius sp. 217	Silicibacter TM1040	Silicibacter pomeroyi DSS-3	Sulfitobacter sp. EE-36	Fructosyl-amino acid oxidase (EC 1.5.3.-)
socQ	Hyphomonas neptunium ATCC 15444	Jannaschia sp. CCS1	Loktanella vestfoldensis SKA53	Oceanicaulis alexandrii HTCC2633	Oceanicola batsensis HTCC2597	Oceanicola granulosus HTCC2516	Paracoccus denitrificans PD1222	Rhodobacter sphaeroides 2.4.1 Gene: RSP_3948: Opine ABC transporter, ATP-binding protein	Rhodobacterales bacterium HTCC2654	Roseobacter sp. MED193	Roseovarius nubinhibens ISM	Roseovarius sp. 217	Silicibacter TM1040	Silicibacter pomeroyi DSS-3	Sulfitobacter sp. EE-36	Opine ABC transporter, ATP-binding protein

Bluish color - the gene is in regulated operon. Different regulated operons are shown in different shades of blue.

Red color - the gene is in non-regulated operon.

Gray color - the orthologous gene is absent.

The star symbol - the TFBS is located in upstream region of this gene.

The number - the numeber of homologs (shown only if it is greater than one).

Export
	Regulated Genes	[ Tab delimited format ]	DOWNLOAD
	Regulatory Sites	[ FASTA format ]	DOWNLOAD

Collection of Manually Curated Inferences of Regulons in Prokaryotic Genomes -- version 3.2 --

Regulog SocR - Rhodobacterales

Collection of Manually Curated Inferences of Regulons in Prokaryotic Genomes
-- version 3.2 --