Profile of regulator SocR in Rhodobacterales
| Regulator family: | LacI |
| Regulation mode: | repressor |
| Biological process: | Santhopine utilization |
| Effector: | |
| Regulog: | SocR - Rhodobacterales |
Member of regulog collections
- By taxonomy - Rhodobacterales
- By TF family - LacI
- By pathway - Santhopine utilization
Transcription factor binding sites
| Locus Tag | Name | Position | Score | Sequence | |
|---|---|---|---|---|---|
| Rhodobacter sphaeroides 2.4.1 | |||||
| RSP_3940 | socL | -72 | 5.7 | GTATGAGATCGGTCTCTCAG | |
|
Regulatory Sites | [ FASTA format ] | DOWNLOAD |