Regulon of MntR in Roseovarius nubinhibens ISM

Properties
Regulator type:	Transcription factor
TF locus tag:	ISM_17630
Regulator family:	DtxR
Regulation mode:	repressor
Biological process:	Manganese homeostasis
Effector:	Manganese ion, (Mn2+)
Regulog:	MntR - Rhodobacterales
Statistics of regulated genes:
- Genes	3
- Operons	2
Visualization:
	Allows to visualize regulon content in the context of metabolic pathways

Built upon 5 sites [see more]

Member of regulog collections

By taxonomy - Rhodobacterales
By trascription factor - MntR
By TF family - DtxR
By effector - Manganese ion, (Mn2+)
By pathway - Manganese homeostasis

Regulated operons
	Locus Tag	Name	Function
Position: -70 Score: 5.4 Sequence: AAAGTTAGCTTCGGCTAATAAT Locus tag: ISM_17630 Name: mntR Funciton: Manganese homeostasis transcriptional regulator MntR, DtxR family
	ISM_17630	mntR	Manganese homeostasis transcriptional regulator MntR, DtxR family
Position: -278 Score: 5.4 Sequence: ATTATTAGCCGAAGCTAACTTT Locus tag: ISM_17635 Name: COG2132 Funciton: Putative metal oxidase Locus tag: ISM_17640 Name: COG0428 Funciton: Putative metal cation transporter
	ISM_17635	COG2132	Putative metal oxidase
	ISM_17640	COG0428	Putative metal cation transporter

Export
	Regulated Genes	[ Tab delimited format ]	DOWNLOAD
	Regulatory Sites	[ FASTA format ]	DOWNLOAD