Regulog MntR - Rhodobacterales

Properties
Regulator type:	Transcription factor
Regulator family:	DtxR
Regulation mode:	repressor
Biological process:	Manganese homeostasis
Effector:	Manganese ion, (Mn2+)
Phylum:	Proteobacteria/alpha
Visualization:
	Allows to visualize regulog content in the context of metabolic pathways

Built upon 5 sites [see more]

Member of regulog collections

By taxonomy - Rhodobacterales
By trascription factor - MntR
By TF family - DtxR
By effector - Manganese ion, (Mn2+)
By pathway - Manganese homeostasis

Statistics of regulated genes
Genome	Genes	Operons
Rhodobacter sphaeroides 2.4.1
Paracoccus denitrificans PD1222
Jannaschia sp. CCS1
Rhodobacterales bacterium HTCC2654	3	2
Oceanicola granulosus HTCC2516
Loktanella vestfoldensis SKA53
Oceanicola batsensis HTCC2597
Roseovarius nubinhibens ISM	3	2
Roseovarius sp. 217	1	1
Sulfitobacter sp. EE-36
Silicibacter TM1040
Silicibacter pomeroyi DSS-3
Roseobacter sp. MED193
Hyphomonas neptunium ATCC 15444
Oceanicaulis alexandrii HTCC2633

Clusters of co-Regulated Orthologous operoNs (CRONs)
Genes																Function

CRON 1.
mntR	Rhodobacter sphaeroides 2.4.1	Paracoccus denitrificans PD1222	Jannaschia sp. CCS1	* Rhodobacterales bacterium HTCC2654 Site: position = -77 score = 6.46305 sequence = AAAGTTAGACATGGCTAACTTA Gene: RB2654_22338: Manganese homeostasis transcriptional regulator MntR, DtxR family	Oceanicola granulosus HTCC2516	Loktanella vestfoldensis SKA53	Oceanicola batsensis HTCC2597	* Roseovarius nubinhibens ISM Site: position = -70 score = 5.3924 sequence = AAAGTTAGCTTCGGCTAATAAT Gene: ISM_17630: Manganese homeostasis transcriptional regulator MntR, DtxR family	* Roseovarius sp. 217 Site: position = -77 score = 6.27131 sequence = AAAGTTAGACATGGCTAATTTA Gene: ROS217_03050: Manganese homeostasis transcriptional regulator MntR, DtxR family	Sulfitobacter sp. EE-36	Silicibacter TM1040	Silicibacter pomeroyi DSS-3	Roseobacter sp. MED193	Hyphomonas neptunium ATCC 15444	Oceanicaulis alexandrii HTCC2633	Manganese homeostasis transcriptional regulator MntR, DtxR family

CRON 2.
COG2132	Rhodobacter sphaeroides 2.4.1	Paracoccus denitrificans PD1222	Jannaschia sp. CCS1	* Rhodobacterales bacterium HTCC2654 Site: position = -98 score = 4.61516 sequence = GGAGTTAAAAGATGCTGACTCG Gene: RB2654_12814: Putative metal oxidase	Oceanicola granulosus HTCC2516	Loktanella vestfoldensis SKA53	Oceanicola batsensis HTCC2597	* Roseovarius nubinhibens ISM Site: position = -278 score = 5.3924 sequence = ATTATTAGCCGAAGCTAACTTT Gene: ISM_17635: Putative metal oxidase	Roseovarius sp. 217 Gene: ROS217_10017: Putative metal oxidase	Sulfitobacter sp. EE-36	Silicibacter TM1040	Silicibacter pomeroyi DSS-3	Roseobacter sp. MED193	Hyphomonas neptunium ATCC 15444	Oceanicaulis alexandrii HTCC2633	Putative metal oxidase
COG0428	Rhodobacter sphaeroides 2.4.1	Paracoccus denitrificans PD1222	Jannaschia sp. CCS1	Rhodobacterales bacterium HTCC2654 Gene: RB2654_12809: Putative metal cation transporter	Oceanicola granulosus HTCC2516	Loktanella vestfoldensis SKA53	Oceanicola batsensis HTCC2597	Roseovarius nubinhibens ISM Gene: ISM_17640: Putative metal cation transporter	Roseovarius sp. 217 Gene: ROS217_10012: Putative metal cation transporter	Sulfitobacter sp. EE-36	Silicibacter TM1040	Silicibacter pomeroyi DSS-3	Roseobacter sp. MED193	Hyphomonas neptunium ATCC 15444	Oceanicaulis alexandrii HTCC2633	Putative metal cation transporter

Bluish color - the gene is in regulated operon. Different regulated operons are shown in different shades of blue.

Red color - the gene is in non-regulated operon.

Gray color - the orthologous gene is absent.

The star symbol - the TFBS is located in upstream region of this gene.

The number - the numeber of homologs (shown only if it is greater than one).

Export
	Regulated Genes	[ Tab delimited format ]	DOWNLOAD
	Regulatory Sites	[ FASTA format ]	DOWNLOAD

Collection of Manually Curated Inferences of Regulons in Prokaryotic Genomes -- version 3.2 --

Regulog MntR - Rhodobacterales

Collection of Manually Curated Inferences of Regulons in Prokaryotic Genomes
-- version 3.2 --