Regulon of MntR in Xanthomonas campestris pv. campestris str. ATCC 33913

Properties
Regulator type:	Transcription factor
TF locus tag:	XCC2170
Regulator family:	DtxR
Regulation mode:	repressor
Biological process:	Manganese homeostasis
Effector:	Manganese ion, (Mn2+)
Regulog:	MntR - Xanthomonadales
Statistics of regulated genes:
- Genes	2
- Operons	2
Visualization:
	Allows to visualize regulon content in the context of metabolic pathways

Built upon 8 sites [see more]

Member of regulog collections

By taxonomy - Xanthomonadales
By trascription factor - MntR
By TF family - DtxR
By effector - Manganese ion, (Mn2+)
By pathway - Manganese homeostasis

Regulated operons
	Locus Tag	Name	Function
Position: -113 Score: 6.2 Sequence: GATATAGCAAGTGCTATGCT Locus tag: XCC2170 Name: mntR Funciton: Manganese homeostasis transcriptional regulator MntR, DtxR family
	XCC2170	mntR	Manganese homeostasis transcriptional regulator MntR, DtxR family
Position: -50 Score: 6.2 Sequence: AGCATAGCACTTGCTATATC Locus tag: XCC2171 Name: mntH Funciton: Manganese transporter, NRAMP family
	XCC2171	mntH	Manganese transporter, NRAMP family

Export
	Regulated Genes	[ Tab delimited format ]	DOWNLOAD
	Regulatory Sites	[ FASTA format ]	DOWNLOAD