Regulog MntR - Xanthomonadales
| Regulator type: | Transcription factor |
| Regulator family: | DtxR |
| Regulation mode: | repressor |
| Biological process: | Manganese homeostasis |
| Effector: | Manganese ion, (Mn2+) |
| Phylum: | Proteobacteria/gamma |
| Visualization: | |
|
Allows to visualize regulog content in the context of metabolic pathways |
Member of regulog collections
- By taxonomy - Xanthomonadales
- By trascription factor - MntR
- By TF family - DtxR
- By effector - Manganese ion, (Mn2+)
- By pathway - Manganese homeostasis
| Genome | Genes | Operons |
|---|---|---|
| Xylella fastidiosa 9a5c | 2 | 2 |
| Xanthomonas axonopodis pv. citri str. 306 | 2 | 2 |
| Xanthomonas campestris pv. campestris str. ATCC 33913 | 2 | 2 |
| Stenotrophomonas maltophilia K279a | 2 | 2 |
| Genes | Function | ||||
|---|---|---|---|---|---|
| CRON 1. | |||||
| mntR |
*
Xylella fastidiosa 9a5c Site: position = -193 score = 5.62916 sequence = CTTATAGCATTGGCTATACC Gene: XF1013: Manganese homeostasis transcriptional regulator MntR, DtxR family |
*
Xanthomonas axonopodis pv. citri str. 306 Site: position = -113 score = 6.2331 sequence = GATATAGCAGTTGCTATGCT Gene: XAC2037: Manganese homeostasis transcriptional regulator MntR, DtxR family |
*
Xanthomonas campestris pv. campestris str. ATCC 33913 Site: position = -113 score = 6.2331 sequence = GATATAGCAAGTGCTATGCT Gene: XCC2170: Manganese homeostasis transcriptional regulator MntR, DtxR family |
*
Stenotrophomonas maltophilia K279a Site: position = -110 score = 5.93778 sequence = AATATAGCTCCTGCTATAGT Gene: Smlt2837: Manganese homeostasis transcriptional regulator MntR, DtxR family |
Manganese homeostasis transcriptional regulator MntR, DtxR family |
| CRON 2. | |||||
| mntH |
*
Xylella fastidiosa 9a5c Site: position = 9 score = 5.62916 sequence = GGTATAGCCAATGCTATAAG Gene: XF1015: Manganese transporter, NRAMP family |
*
Xanthomonas axonopodis pv. citri str. 306 Site: position = -49 score = 6.2331 sequence = AGCATAGCAACTGCTATATC Gene: XAC2036: Manganese transporter, NRAMP family |
*
Xanthomonas campestris pv. campestris str. ATCC 33913 Site: position = -50 score = 6.2331 sequence = AGCATAGCACTTGCTATATC Gene: XCC2171: Manganese transporter, NRAMP family |
*
Stenotrophomonas maltophilia K279a Site: position = -27 score = 5.93778 sequence = ACTATAGCAGGAGCTATATT Gene: Smlt2838: Manganese transporter, NRAMP family |
Manganese transporter, NRAMP family |
Bluish color - the gene is in regulated operon. Different regulated operons are shown in different shades of blue.
Red color - the gene is in non-regulated operon.
Gray color - the orthologous gene is absent.
The star symbol - the TFBS is located in upstream region of this gene.
The number - the numeber of homologs (shown only if it is greater than one).
|
Regulated Genes | [ Tab delimited format ] | DOWNLOAD |
|
Regulatory Sites | [ FASTA format ] | DOWNLOAD |