Regulon of GntR in Xanthobacter autotrophicus Py2

Properties
Regulator type:	Transcription factor
TF locus tag:	Xaut_1236
Regulator family:	LacI
Regulation mode:	repressor
Biological process:	Gluconate utilization
Effector:	Gluconate
Regulog:	GntR - Rhizobiales
Statistics of regulated genes:
- Genes	3
- Operons	3
Visualization:
	Allows to visualize regulon content in the context of metabolic pathways

Built upon 4 sites [see more]

Member of regulog collections

By taxonomy - Rhizobiales
By trascription factor - GntR
By TF family - LacI
By effector - Gluconate
By pathway - Gluconate utilization

Regulated operons
	Locus Tag	Name	Function
Position: -204 Score: 5.8 Sequence: ATAAGATAACGCTATCTTGA Position: -61 Score: 6.3 Sequence: GAAAGACAGCGCTATCTCAG Locus tag: Xaut_1235 Name: gntK Funciton: Thermoresistant gluconokinase (EC 2.7.1.12)
	Xaut_1235	gntK	Thermoresistant gluconokinase (EC 2.7.1.12)
Position: -124 Score: 6.6 Sequence: GCGAGATAGCGCTATCTCAC Locus tag: Xaut_1234 Name: gntT Funciton: High-affinity H+/gluconate symporter
	Xaut_1234	gntT	High-affinity H+/gluconate symporter
Position: -161 Score: 6.3 Sequence: CTGAGATAGCGCTGTCTTTC Locus tag: Xaut_1236 Name: gntR Funciton: Gluconate utilization transcriptional regulator GntR, LacI family
	Xaut_1236	gntR	Gluconate utilization transcriptional regulator GntR, LacI family

Export
	Regulated Genes	[ Tab delimited format ]	DOWNLOAD
	Regulatory Sites	[ FASTA format ]	DOWNLOAD