Regulog GntR - Rhizobiales
| Regulator type: | Transcription factor |
| Regulator family: | LacI |
| Regulation mode: | repressor |
| Biological process: | Gluconate utilization |
| Effector: | Gluconate |
| Phylum: | Proteobacteria/alpha |
| Visualization: | |
|
Allows to visualize regulog content in the context of metabolic pathways |
Member of regulog collections
- By taxonomy - Rhizobiales
- By trascription factor - GntR
- By TF family - LacI
- By effector - Gluconate
- By pathway - Gluconate utilization
| Genome | Genes | Operons |
|---|---|---|
| Sinorhizobium meliloti 1021 | ||
| Rhizobium sp. NGR234 | ||
| Rhizobium leguminosarum bv. viciae 3841 | ||
| Rhizobium etli CFN 42 | ||
| Agrobacterium tumefaciens str. C58 (Cereon) | ||
| Mesorhizobium sp. BNC1 | ||
| Mesorhizobium loti MAFF303099 | ||
| Brucella melitensis 16M | ||
| Bartonella quintana str. Toulouse | ||
| Rhodopseudomonas palustris CGA009 | ||
| Bradyrhizobium japonicum USDA 110 | ||
| Bradyrhizobium sp. BTAi1 | ||
| Nitrobacter winogradskyi Nb-255 | ||
| Azorhizobium caulinodans ORS 571 | ||
| Xanthobacter autotrophicus Py2 | 3 | 3 |
| Genes | Function | |||||||||||||||
|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|
| CRON 1. | ||||||||||||||||
| gntR |
|
|
|
|
|
|
|
|
|
|
|
|
|
|
*
Xanthobacter autotrophicus Py2 Site: position = -161 score = 6.29553 sequence = CTGAGATAGCGCTGTCTTTC Gene: Xaut_1236: Gluconate utilization transcriptional regulator GntR, LacI family |
Gluconate utilization transcriptional regulator GntR, LacI family |
| CRON 2. | ||||||||||||||||
| gntK |
|
|
|
|
|
Gene: Meso_0316: Thermoresistant gluconokinase (EC 2.7.1.12) |
Gene: mll1676: Thermoresistant gluconokinase (EC 2.7.1.12) |
|
|
|
|
|
|
|
*
Xanthobacter autotrophicus Py2 Site: position = -204 score = 5.8444 sequence = ATAAGATAACGCTATCTTGA Site: position = -61 score = 6.29553 sequence = GAAAGACAGCGCTATCTCAG Gene: Xaut_1235: Thermoresistant gluconokinase (EC 2.7.1.12) |
Thermoresistant gluconokinase (EC 2.7.1.12) |
| CRON 3. | ||||||||||||||||
| gntT |
|
|
|
|
|
|
|
|
|
|
|
|
|
|
*
Xanthobacter autotrophicus Py2 Site: position = -124 score = 6.59915 sequence = GCGAGATAGCGCTATCTCAC Gene: Xaut_1234: High-affinity H+/gluconate symporter |
High-affinity H+/gluconate symporter |
Bluish color - the gene is in regulated operon. Different regulated operons are shown in different shades of blue.
Red color - the gene is in non-regulated operon.
Gray color - the orthologous gene is absent.
The star symbol - the TFBS is located in upstream region of this gene.
The number - the numeber of homologs (shown only if it is greater than one).
|
Regulated Genes | [ Tab delimited format ] | DOWNLOAD |
|
Regulatory Sites | [ FASTA format ] | DOWNLOAD |