Regulon of HrcA in Azorhizobium caulinodans ORS 571

Properties
Regulator type:	Transcription factor
TF locus tag:	AZC_4287
Regulator family:	HrcA
Regulation mode:	repressor
Biological process:	Heat shock response
Effector:	Heat shock
Regulog:	HrcA - Rhizobiales
Statistics of regulated genes:
- Genes	4
- Operons	2
Visualization:
	Allows to visualize regulon content in the context of metabolic pathways

Built upon 38 sites [see more]

Member of regulog collections

By taxonomy - Rhizobiales
By trascription factor - HrcA
By TF family - HrcA
By effector - Heat shock
By pathway - Heat shock response

Regulated operons
	Locus Tag	Name	Function
Position: -184 Score: 6.7 Sequence: TTGGCACTCATGGGAGAGGAGTGCTAA Locus tag: AZC_2311 Name: groS Funciton: Heat shock protein 60 family co-chaperone GroES Locus tag: AZC_2312 Name: groL Funciton: Heat shock protein 60 family chaperone GroEL
	AZC_2311	groS	Heat shock protein 60 family co-chaperone GroES
	AZC_2312	groL	Heat shock protein 60 family chaperone GroEL
Position: -71 Score: 6.5 Sequence: TTGGCACTCCCATCCGGTGAGTGCCAG Locus tag: AZC_0425 Name: groS Funciton: Heat shock protein 60 family co-chaperone GroES Locus tag: AZC_0424 Name: groL Funciton: Heat shock protein 60 family chaperone GroEL
	AZC_0425	groS	Heat shock protein 60 family co-chaperone GroES
	AZC_0424	groL	Heat shock protein 60 family chaperone GroEL

Export
	Regulated Genes	[ Tab delimited format ]	DOWNLOAD
	Regulatory Sites	[ FASTA format ]	DOWNLOAD