Regulon of HrcA in Nitrobacter winogradskyi Nb-255

Properties
Regulator type:	Transcription factor
TF locus tag:	Nwi_0194
Regulator family:	HrcA
Regulation mode:	repressor
Biological process:	Heat shock response
Effector:	Heat shock
Regulog:	HrcA - Rhizobiales
Statistics of regulated genes:
- Genes	6
- Operons	3
Visualization:
	Allows to visualize regulon content in the context of metabolic pathways

Built upon 38 sites [see more]

Member of regulog collections

By taxonomy - Rhizobiales
By trascription factor - HrcA
By TF family - HrcA
By effector - Heat shock
By pathway - Heat shock response

Regulated operons
	Locus Tag	Name	Function
Position: -117 Score: 6 Sequence: GTGGCACTCTCGCAATACGATTGCCAA Locus tag: Nwi_2573 Name: groS Funciton: Heat shock protein 60 family co-chaperone GroES Locus tag: Nwi_2574 Name: groL Funciton: Heat shock protein 60 family chaperone GroEL
	Nwi_2573	groS	Heat shock protein 60 family co-chaperone GroES
	Nwi_2574	groL	Heat shock protein 60 family chaperone GroEL
Position: -70 Score: 5.8 Sequence: CTGGCACTCGCTGGTATTGACTGCCAG Locus tag: Nwi_2191 Name: groS Funciton: Heat shock protein 60 family co-chaperone GroES Locus tag: Nwi_2192 Name: groL Funciton: Heat shock protein 60 family chaperone GroEL
	Nwi_2191	groS	Heat shock protein 60 family co-chaperone GroES
	Nwi_2192	groL	Heat shock protein 60 family chaperone GroEL
Position: -144 Score: 5.8 Sequence: TTGGCGCTCCAGGGCGCGGAGTGCCAA Locus tag: Nwi_2114 Name: groS Funciton: Heat shock protein 60 family co-chaperone GroES Locus tag: Nwi_2113 Name: groL Funciton: Heat shock protein 60 family chaperone GroEL
	Nwi_2114	groS	Heat shock protein 60 family co-chaperone GroES
	Nwi_2113	groL	Heat shock protein 60 family chaperone GroEL

Export
	Regulated Genes	[ Tab delimited format ]	DOWNLOAD
	Regulatory Sites	[ FASTA format ]	DOWNLOAD