Regulon of HrcA in Bradyrhizobium sp. BTAi1

Properties
Regulator type:	Transcription factor
TF locus tag:	BBta_0187
Regulator family:	HrcA
Regulation mode:	repressor
Biological process:	Heat shock response
Effector:	Heat shock
Regulog:	HrcA - Rhizobiales
Statistics of regulated genes:
- Genes	6
- Operons	3
Visualization:
	Allows to visualize regulon content in the context of metabolic pathways

Built upon 38 sites [see more]

Member of regulog collections

By taxonomy - Rhizobiales
By trascription factor - HrcA
By TF family - HrcA
By effector - Heat shock
By pathway - Heat shock response

Regulated operons
	Locus Tag	Name	Function
Position: -71 Score: 6.4 Sequence: CTGGCACTCGCCGGCAGCGACTGCCAA Locus tag: BBta_5284 Name: groS Funciton: Heat shock protein 60 family co-chaperone GroES Locus tag: BBta_5285 Name: groL Funciton: Heat shock protein 60 family chaperone GroEL
	BBta_5284	groS	Heat shock protein 60 family co-chaperone GroES
	BBta_5285	groL	Heat shock protein 60 family chaperone GroEL
Position: -126 Score: 6.5 Sequence: TTAGCACTCGGAGGGCACGATTGCTAA Locus tag: BBta_1672 Name: groS Funciton: Heat shock protein 60 family co-chaperone GroES Locus tag: BBta_1671 Name: groL Funciton: Heat shock protein 60 family chaperone GroEL
	BBta_1672	groS	Heat shock protein 60 family co-chaperone GroES
	BBta_1671	groL	Heat shock protein 60 family chaperone GroEL
Position: -143 Score: 6.1 Sequence: CTGGCAATCGTTCCCACCGAGTGCCAA Locus tag: BBta_3033 Name: groS Funciton: Heat shock protein 60 family co-chaperone GroES Locus tag: BBta_3034 Name: groL Funciton: Heat shock protein 60 family chaperone GroEL
	BBta_3033	groS	Heat shock protein 60 family co-chaperone GroES
	BBta_3034	groL	Heat shock protein 60 family chaperone GroEL

Export
	Regulated Genes	[ Tab delimited format ]	DOWNLOAD
	Regulatory Sites	[ FASTA format ]	DOWNLOAD