Regulon of HrcA in Bradyrhizobium japonicum USDA 110

Properties
Regulator type:	Transcription factor
TF locus tag:	blr0675
Regulator family:	HrcA
Regulation mode:	repressor
Biological process:	Heat shock response
Effector:	Heat shock
Regulog:	HrcA - Rhizobiales
Statistics of regulated genes:
- Genes	7
- Operons	4
Visualization:
	Allows to visualize regulon content in the context of metabolic pathways

Built upon 38 sites [see more]

Member of regulog collections

By taxonomy - Rhizobiales
By trascription factor - HrcA
By TF family - HrcA
By effector - Heat shock
By pathway - Heat shock response

Regulated operons
	Locus Tag	Name	Function
Position: -119 Score: 6.5 Sequence: TTAGCACTCGGAAAGCCCGATTGCTAA Locus tag: bsr7532 Name: groS Funciton: Heat shock protein 60 family co-chaperone GroES Locus tag: blr7533 Name: groL Funciton: Heat shock protein 60 family chaperone GroEL
	bsr7532	groS	Heat shock protein 60 family co-chaperone GroES
	blr7533	groL	Heat shock protein 60 family chaperone GroEL
Position: -59 Score: 5.5 Sequence: TCAGCACTCGCTAGCTTCGACTGCTAT Locus tag: blr6978 Name: groS Funciton: Heat shock protein 60 family co-chaperone GroES Locus tag: blr6979 Name: groL Funciton: Heat shock protein 60 family chaperone GroEL
	blr6978	groS	Heat shock protein 60 family co-chaperone GroES
	blr6979	groL	Heat shock protein 60 family chaperone GroEL
Position: -70 Score: 6.4 Sequence: CTAGCACTCGCGGGCACAGACTGCTAA Locus tag: blr5625 Name: groS Funciton: Heat shock protein 60 family co-chaperone GroES Locus tag: blr5626 Name: groL Funciton: Heat shock protein 60 family chaperone GroEL
	blr5625	groS	Heat shock protein 60 family co-chaperone GroES
	blr5626	groL	Heat shock protein 60 family chaperone GroEL
Position: -137 Score: 5.4 Sequence: TTGGCAGTCAGACGGCCGGAGTGACAA Locus tag: blr5226 Name: groS Funciton: Heat shock protein 60 family co-chaperone GroES
	blr5226	groS	Heat shock protein 60 family co-chaperone GroES

Export
	Regulated Genes	[ Tab delimited format ]	DOWNLOAD
	Regulatory Sites	[ FASTA format ]	DOWNLOAD