Regulon of HrcA in Rhodopseudomonas palustris CGA009

Properties
Regulator type:	Transcription factor
TF locus tag:	RPA0330
Regulator family:	HrcA
Regulation mode:	repressor
Biological process:	Heat shock response
Effector:	Heat shock
Regulog:	HrcA - Rhizobiales
Statistics of regulated genes:
- Genes	4
- Operons	2
Visualization:
	Allows to visualize regulon content in the context of metabolic pathways

Built upon 38 sites [see more]

Member of regulog collections

By taxonomy - Rhizobiales
By trascription factor - HrcA
By TF family - HrcA
By effector - Heat shock
By pathway - Heat shock response

Regulated operons
	Locus Tag	Name	Function
Position: -109 Score: 6.5 Sequence: TTAGCACTCTTGCAGTACGACTGCCAA Locus tag: RPA1141 Name: groS Funciton: Heat shock protein 60 family co-chaperone GroES Locus tag: RPA1140 Name: groL Funciton: Heat shock protein 60 family chaperone GroEL
	RPA1141	groS	Heat shock protein 60 family co-chaperone GroES
	RPA1140	groL	Heat shock protein 60 family chaperone GroEL
Position: -69 Score: 6.2 Sequence: CTGGCACTCTTCGCCCGCGACTGCCAA Locus tag: RPA2165 Name: groS Funciton: Heat shock protein 60 family co-chaperone GroES Locus tag: RPA2164 Name: groL Funciton: Heat shock protein 60 family chaperone GroEL
	RPA2165	groS	Heat shock protein 60 family co-chaperone GroES
	RPA2164	groL	Heat shock protein 60 family chaperone GroEL

Export
	Regulated Genes	[ Tab delimited format ]	DOWNLOAD
	Regulatory Sites	[ FASTA format ]	DOWNLOAD