Collection of Manually Curated Inferences of Regulons in Prokaryotic Genomes
-- version 3.2 --

Regulon of HrcA in Bartonella quintana str. Toulouse

Properties
Regulator type: Transcription factor
TF locus tag: BQ00490
Regulator family: HrcA
Regulation mode: repressor
Biological process: Heat shock response
Effector: Heat shock
Regulog: HrcA - Rhizobiales
Statistics of regulated genes:
- Genes 2
- Operons 1
Visualization:
Allows to visualize regulon content in the context of metabolic pathways
Built upon 38 sites [see more]
Member of regulog collections
Regulated operons
Locus Tag Name Function

Position: -76
Score: 6.9
Sequence: TTAGCACTCTCCAACTATGAGTGCTAA
Locus tag: BQ10760
Name: groS
Funciton: Heat shock protein 60 family co-chaperone GroES
Locus tag: BQ10750
Name: groL
Funciton: Heat shock protein 60 family chaperone GroEL
groS
Heat shock protein 60 family co-chaperone GroES
groL
Heat shock protein 60 family chaperone GroEL
Export
Regulated Genes [ Tab delimited format ] DOWNLOAD
Regulatory Sites [ FASTA format ] DOWNLOAD