Regulon of HrcA in Mesorhizobium loti MAFF303099

Properties
Regulator type:	Transcription factor
TF locus tag:	mll4621
Regulator family:	HrcA
Regulation mode:	repressor
Biological process:	Heat shock response
Effector:	Heat shock
Regulog:	HrcA - Rhizobiales
Statistics of regulated genes:
- Genes	10
- Operons	5
Visualization:
	Allows to visualize regulon content in the context of metabolic pathways

Built upon 38 sites [see more]

Member of regulog collections

By taxonomy - Rhizobiales
By trascription factor - HrcA
By TF family - HrcA
By effector - Heat shock
By pathway - Heat shock response

Regulated operons
	Locus Tag	Name	Function
Position: -81 Score: 7.1 Sequence: TTAGCACTCGCCTCTGCCGAGTGCTAA Locus tag: msr9341 Name: groS Funciton: Heat shock protein 60 family co-chaperone GroES Locus tag: mlr9342 Name: groL Funciton: Heat shock protein 60 family chaperone GroEL
	msr9341	groS	Heat shock protein 60 family co-chaperone GroES
	mlr9342	groL	Heat shock protein 60 family chaperone GroEL
Position: -79 Score: 7.2 Sequence: TTAGCACTCCCCAATAGCGAGTGCTAA Locus tag: msl5812 Name: groS Funciton: Heat shock protein 60 family co-chaperone GroES Locus tag: mll5810 Name: groL Funciton: Heat shock protein 60 family chaperone GroEL
	msl5812	groS	Heat shock protein 60 family co-chaperone GroES
	mll5810	groL	Heat shock protein 60 family chaperone GroEL
Position: -183 Score: 6.7 Sequence: CTAGCACTCTCGCACGCCGAGTGCCAA Locus tag: mlr2393 Name: groS Funciton: Heat shock protein 60 family co-chaperone GroES Locus tag: mlr2394 Name: groL Funciton: Heat shock protein 60 family chaperone GroEL
	mlr2393	groS	Heat shock protein 60 family co-chaperone GroES
	mlr2394	groL	Heat shock protein 60 family chaperone GroEL
Position: -91 Score: 7.2 Sequence: TTAGCACTCGCCCTTGGTGAGTGCTAA Locus tag: mll8202 Name: groS Funciton: Heat shock protein 60 family co-chaperone GroES Locus tag: mll8201 Name: groL Funciton: Heat shock protein 60 family chaperone GroEL
	mll8202	groS	Heat shock protein 60 family co-chaperone GroES
	mll8201	groL	Heat shock protein 60 family chaperone GroEL
Position: -80 Score: 6.5 Sequence: TTGGCACTCCTATCTATCGAGTGCCAA Locus tag: mll2233 Name: groS Funciton: Heat shock protein 60 family co-chaperone GroES Locus tag: mll2232 Name: groL Funciton: Heat shock protein 60 family chaperone GroEL
	mll2233	groS	Heat shock protein 60 family co-chaperone GroES
	mll2232	groL	Heat shock protein 60 family chaperone GroEL

Export
	Regulated Genes	[ Tab delimited format ]	DOWNLOAD
	Regulatory Sites	[ FASTA format ]	DOWNLOAD