Regulon of HrcA in Rhizobium etli CFN 42

Properties
Regulator type:	Transcription factor
TF locus tag:	RHE_CH00364
Regulator family:	HrcA
Regulation mode:	repressor
Biological process:	Heat shock response
Effector:	Heat shock
Regulog:	HrcA - Rhizobiales
Statistics of regulated genes:
- Genes	8
- Operons	4
Visualization:
	Allows to visualize regulon content in the context of metabolic pathways

Built upon 38 sites [see more]

Member of regulog collections

By taxonomy - Rhizobiales
By trascription factor - HrcA
By TF family - HrcA
By effector - Heat shock
By pathway - Heat shock response

Regulated operons
	Locus Tag	Name	Function
Position: -169 Score: 6.8 Sequence: TTAGCAGTCGTCGATAGAGAGTGCTAA Locus tag: RHE_PF00329 Name: groS Funciton: Heat shock protein 60 family co-chaperone GroES Locus tag: RHE_PF00330 Name: groL Funciton: Heat shock protein 60 family chaperone GroEL
	RHE_PF00329	groS	Heat shock protein 60 family co-chaperone GroES
	RHE_PF00330	groL	Heat shock protein 60 family chaperone GroEL
Position: -85 Score: 6.9 Sequence: CTAGCACTCACCGCAAGGGAGTGCTAA Locus tag: RHE_CH00829 Name: groS Funciton: Heat shock protein 60 family co-chaperone GroES Locus tag: RHE_CH00828 Name: groL Funciton: Heat shock protein 60 family chaperone GroEL
	RHE_CH00829	groS	Heat shock protein 60 family co-chaperone GroES
	RHE_CH00828	groL	Heat shock protein 60 family chaperone GroEL
Position: -81 Score: 6.1 Sequence: TTGGCACTCCTATCAATCGAGTGCCAC Locus tag: RHE_CH01270 Name: groS Funciton: Heat shock protein 60 family co-chaperone GroES Locus tag: RHE_CH01271 Name: groL Funciton: Heat shock protein 60 family chaperone GroEL
	RHE_CH01270	groS	Heat shock protein 60 family co-chaperone GroES
	RHE_CH01271	groL	Heat shock protein 60 family chaperone GroEL
Position: -177 Score: 6 Sequence: TTAGCAGCCACTTCGAGTGAGTGCTAA Locus tag: RHE_CH01238 Name: groS Funciton: Heat shock protein 60 family co-chaperone GroES Locus tag: RHE_CH01239 Name: groL Funciton: Heat shock protein 60 family chaperone GroEL
	RHE_CH01238	groS	Heat shock protein 60 family co-chaperone GroES
	RHE_CH01239	groL	Heat shock protein 60 family chaperone GroEL

Export
	Regulated Genes	[ Tab delimited format ]	DOWNLOAD
	Regulatory Sites	[ FASTA format ]	DOWNLOAD