Regulon of HrcA in Rhizobium leguminosarum bv. viciae 3841

Properties
Regulator type:	Transcription factor
TF locus tag:	RL0381
Regulator family:	HrcA
Regulation mode:	repressor
Biological process:	Heat shock response
Effector:	Heat shock
Regulog:	HrcA - Rhizobiales
Statistics of regulated genes:
- Genes	6
- Operons	3
Visualization:
	Allows to visualize regulon content in the context of metabolic pathways

Built upon 38 sites [see more]

Member of regulog collections

By taxonomy - Rhizobiales
By trascription factor - HrcA
By TF family - HrcA
By effector - Heat shock
By pathway - Heat shock response

Regulated operons
	Locus Tag	Name	Function
Position: -85 Score: 6.9 Sequence: CTAGCACTCACCGCAAGGGAGTGCTAA Locus tag: RL0884 Name: groS Funciton: Heat shock protein 60 family co-chaperone GroES Locus tag: RL0883 Name: groL Funciton: Heat shock protein 60 family chaperone GroEL
	RL0884	groS	Heat shock protein 60 family co-chaperone GroES
	RL0883	groL	Heat shock protein 60 family chaperone GroEL
Position: -172 Score: 6.8 Sequence: CTAGCACTCGCGGGCAGGGAGTGCCAA Locus tag: pRL120643 Name: groS Funciton: Heat shock protein 60 family co-chaperone GroES Locus tag: pRL120642 Name: groL Funciton: Heat shock protein 60 family chaperone GroEL
	pRL120643	groS	Heat shock protein 60 family co-chaperone GroES
	pRL120642	groL	Heat shock protein 60 family chaperone GroEL
Position: -81 Score: 6.1 Sequence: TTGGCACTCCTATCAATCGAGTGCCAC Locus tag: RL1410 Name: groS Funciton: Heat shock protein 60 family co-chaperone GroES Locus tag: RL1412 Name: groL Funciton: Heat shock protein 60 family chaperone GroEL
	RL1410	groS	Heat shock protein 60 family co-chaperone GroES
	RL1412	groL	Heat shock protein 60 family chaperone GroEL

Export
	Regulated Genes	[ Tab delimited format ]	DOWNLOAD
	Regulatory Sites	[ FASTA format ]	DOWNLOAD