Regulon of HrcA in Rhizobium sp. NGR234

Properties
Regulator type:	Transcription factor
TF locus tag:	NGR_c00110
Regulator family:	HrcA
Regulation mode:	repressor
Biological process:	Heat shock response
Effector:	Heat shock
Regulog:	HrcA - Rhizobiales
Statistics of regulated genes:
- Genes	6
- Operons	3
Visualization:
	Allows to visualize regulon content in the context of metabolic pathways

Built upon 38 sites [see more]

Member of regulog collections

By taxonomy - Rhizobiales
By trascription factor - HrcA
By TF family - HrcA
By effector - Heat shock
By pathway - Heat shock response

Regulated operons
	Locus Tag	Name	Function
Position: -178 Score: 6.8 Sequence: GTAGCACTCTCAAGTGGCGAGTGCTAA Locus tag: NGR_b05810 Name: groS Funciton: Heat shock protein 60 family co-chaperone GroES Locus tag: NGR_b05820 Name: groL Funciton: Heat shock protein 60 family chaperone GroEL
	NGR_b05810	groS	Heat shock protein 60 family co-chaperone GroES
	NGR_b05820	groL	Heat shock protein 60 family chaperone GroEL
Position: -175 Score: 6.8 Sequence: TTAGCACTCCATGTGATGGAGTGCTAA Locus tag: NGR_b05110 Name: groS Funciton: Heat shock protein 60 family co-chaperone GroES Locus tag: NGR_b05100 Name: groL Funciton: Heat shock protein 60 family chaperone GroEL
	NGR_b05110	groS	Heat shock protein 60 family co-chaperone GroES
	NGR_b05100	groL	Heat shock protein 60 family chaperone GroEL
Position: -85 Score: 6.8 Sequence: CTAGCACTCTTTAAGAAGGAGTGCTAA Locus tag: NGR_c04090 Name: groS Funciton: Heat shock protein 60 family co-chaperone GroES Locus tag: NGR_c04080 Name: groL Funciton: Heat shock protein 60 family chaperone GroEL
	NGR_c04090	groS	Heat shock protein 60 family co-chaperone GroES
	NGR_c04080	groL	Heat shock protein 60 family chaperone GroEL

Export
	Regulated Genes	[ Tab delimited format ]	DOWNLOAD
	Regulatory Sites	[ FASTA format ]	DOWNLOAD