Regulon of HrcA in Sinorhizobium meliloti 1021

Properties
Regulator type:	Transcription factor
TF locus tag:	SMc01143
Regulator family:	HrcA
Regulation mode:	repressor
Biological process:	Heat shock response
Effector:	Heat shock
Regulog:	HrcA - Rhizobiales
Statistics of regulated genes:
- Genes	4
- Operons	2
Visualization:
	Allows to visualize regulon content in the context of metabolic pathways

Built upon 38 sites [see more]

Member of regulog collections

By taxonomy - Rhizobiales
By trascription factor - HrcA
By TF family - HrcA
By effector - Heat shock
By pathway - Heat shock response

Regulated operons
	Locus Tag	Name	Function
Position: -83 Score: 6.9 Sequence: CTAGCACTCTCGCGTGAAGAGTGCTAA Locus tag: SMa0745 Name: groS Funciton: Heat shock protein 60 family co-chaperone GroES Locus tag: SMa0744 Name: groL Funciton: Heat shock protein 60 family chaperone GroEL
	SMa0745	groS	Heat shock protein 60 family co-chaperone GroES
	SMa0744	groL	Heat shock protein 60 family chaperone GroEL
Position: -85 Score: 6.7 Sequence: CTAGCACTCGCTTGATATGAGTGCTAA Locus tag: SMc00912 Name: groS Funciton: Heat shock protein 60 family co-chaperone GroES Locus tag: SMc00913 Name: groL Funciton: Heat shock protein 60 family chaperone GroEL
	SMc00912	groS	Heat shock protein 60 family co-chaperone GroES
	SMc00913	groL	Heat shock protein 60 family chaperone GroEL

Export
	Regulated Genes	[ Tab delimited format ]	DOWNLOAD
	Regulatory Sites	[ FASTA format ]	DOWNLOAD