Regulon of HrcA in Pseudoalteromonas tunicata D2

Properties
Regulator type:	Transcription factor
TF locus tag:	PTD2_10724
Regulator family:	HrcA
Regulation mode:	repressor
Biological process:	Heat shock response
Effector:	Heat shock
Regulog:	HrcA - Alteromonadales
Statistics of regulated genes:
- Genes	1
- Operons	1
Visualization:
	Allows to visualize regulon content in the context of metabolic pathways

Built upon 2 sites [see more]

Member of regulog collections

By taxonomy - Alteromonadales
By trascription factor - HrcA
By TF family - HrcA
By effector - Heat shock
By pathway - Heat shock response

Regulated operons
	Locus Tag	Name	Function
Position: -60 Score: 7.9 Sequence: TTAGCACTCTCGATAAAAGAGTGCTAA Locus tag: PTD2_13624 Name: rpoH Funciton: Heat shock response RNA polymerase sigma factor RpoH (Sigma 32)
	PTD2_13624	rpoH	Heat shock response RNA polymerase sigma factor RpoH (Sigma 32)

Export
	Regulated Genes	[ Tab delimited format ]	DOWNLOAD
	Regulatory Sites	[ FASTA format ]	DOWNLOAD