Regulon of HrcA in Pseudoalteromonas tunicata D2
| Regulator type: | Transcription factor |
| TF locus tag: | PTD2_10724 |
| Regulator family: | HrcA |
| Regulation mode: | repressor |
| Biological process: | Heat shock response |
| Effector: | Heat shock |
| Regulog: | HrcA - Alteromonadales |
| Statistics of regulated genes: | |
| - Genes | 1 |
| - Operons | 1 |
| Visualization: | |
|
Allows to visualize regulon content in the context of metabolic pathways |
Member of regulog collections
- By taxonomy - Alteromonadales
- By trascription factor - HrcA
- By TF family - HrcA
- By effector - Heat shock
- By pathway - Heat shock response
| Locus Tag | Name | Function | |
|---|---|---|---|
|
Position: -60
Score: 7.9 Sequence: TTAGCACTCTCGATAAAAGAGTGCTAA
Locus tag: PTD2_13624
Name: rpoH Funciton: Heat shock response RNA polymerase sigma factor RpoH (Sigma 32) |
|||
|
rpoH
|
Heat shock response RNA polymerase sigma factor RpoH (Sigma 32)
|
||
|
Regulated Genes | [ Tab delimited format ] | DOWNLOAD |
|
Regulatory Sites | [ FASTA format ] | DOWNLOAD |