Collection of Manually Curated Inferences of Regulons in Prokaryotic Genomes
-- version 3.2 --

Regulog HrcA - Alteromonadales

Properties
Regulator type: Transcription factor
Regulator family: HrcA
Regulation mode: repressor
Biological process: Heat shock response
Effector: Heat shock
Phylum: Proteobacteria/gamma
Visualization:
Allows to visualize regulog content in the context of metabolic pathways
Built upon 2 sites [see more]
Member of regulog collections
Statistics of regulated genes
Genome Genes Operons
Pseudoalteromonas atlantica T6c
Alteromonas macleodii 'Deep ecotype'
Glaciecola sp. HTCC2999
Colwellia psychrerythraea 34H
Alteromonadales bacterium TW-7
Pseudoalteromonas haloplanktis TAC125 1 1
Pseudoalteromonas tunicata D2 1 1
Idiomarina baltica OS145
Idiomarina loihiensis L2TR
Clusters of co-Regulated Orthologous operoNs (CRONs)
Genes Function
 
CRON 1.
rpoH
 
Pseudoalteromonas atlantica T6c

Gene: Patl_3948: Heat shock response RNA polymerase sigma factor RpoH (Sigma 32)
 
Alteromonas macleodii 'Deep ecotype'

Gene: MADE_03532: Heat shock response RNA polymerase sigma factor RpoH (Sigma 32)
 
Glaciecola sp. HTCC2999

Gene: GHTCC_010100003209: Heat shock response RNA polymerase sigma factor RpoH (Sigma 32)
 
Colwellia psychrerythraea 34H

Gene: CPS_0161: Heat shock response RNA polymerase sigma factor RpoH (Sigma 32)
 
Alteromonadales bacterium TW-7
*
Pseudoalteromonas haloplanktis TAC125

Site:
position = -60
score = 8.06071
sequence = TTAGCACTCTTAGGTAAAGAGTGCTAA

Gene: PSHAa0357: Heat shock response RNA polymerase sigma factor RpoH (Sigma 32)
*
Pseudoalteromonas tunicata D2

Site:
position = -60
score = 7.89325
sequence = TTAGCACTCTCGATAAAAGAGTGCTAA

Gene: PTD2_13624: Heat shock response RNA polymerase sigma factor RpoH (Sigma 32)
 
Idiomarina baltica OS145

Gene: OS145_02345: Heat shock response RNA polymerase sigma factor RpoH (Sigma 32)
 
Idiomarina loihiensis L2TR

Gene: IL0229: Heat shock response RNA polymerase sigma factor RpoH (Sigma 32)
Heat shock response RNA polymerase sigma factor RpoH (Sigma 32)
Bluish color - the gene is in regulated operon. Different regulated operons are shown in different shades of blue.
Red color - the gene is in non-regulated operon.
Gray color - the orthologous gene is absent.
The star symbol - the TFBS is located in upstream region of this gene.
The number - the numeber of homologs (shown only if it is greater than one).
Export
Regulated Genes [ Tab delimited format ] DOWNLOAD
Regulatory Sites [ FASTA format ] DOWNLOAD
© 2009-2020 RegPrecise