Regulog HrcA - Alteromonadales
| Regulator type: | Transcription factor |
| Regulator family: | HrcA |
| Regulation mode: | repressor |
| Biological process: | Heat shock response |
| Effector: | Heat shock |
| Phylum: | Proteobacteria/gamma |
| Visualization: | |
|
Allows to visualize regulog content in the context of metabolic pathways |
Member of regulog collections
- By taxonomy - Alteromonadales
- By trascription factor - HrcA
- By TF family - HrcA
- By effector - Heat shock
- By pathway - Heat shock response
| Genome | Genes | Operons |
|---|---|---|
| Pseudoalteromonas atlantica T6c | ||
| Alteromonas macleodii 'Deep ecotype' | ||
| Glaciecola sp. HTCC2999 | ||
| Colwellia psychrerythraea 34H | ||
| Alteromonadales bacterium TW-7 | ||
| Pseudoalteromonas haloplanktis TAC125 | 1 | 1 |
| Pseudoalteromonas tunicata D2 | 1 | 1 |
| Idiomarina baltica OS145 | ||
| Idiomarina loihiensis L2TR |
| Genes | Function | |||||||||
|---|---|---|---|---|---|---|---|---|---|---|
| CRON 1. | ||||||||||
| rpoH |
Gene: Patl_3948: Heat shock response RNA polymerase sigma factor RpoH (Sigma 32) |
Gene: MADE_03532: Heat shock response RNA polymerase sigma factor RpoH (Sigma 32) |
Gene: GHTCC_010100003209: Heat shock response RNA polymerase sigma factor RpoH (Sigma 32) |
Gene: CPS_0161: Heat shock response RNA polymerase sigma factor RpoH (Sigma 32) |
|
*
Pseudoalteromonas haloplanktis TAC125 Site: position = -60 score = 8.06071 sequence = TTAGCACTCTTAGGTAAAGAGTGCTAA Gene: PSHAa0357: Heat shock response RNA polymerase sigma factor RpoH (Sigma 32) |
*
Pseudoalteromonas tunicata D2 Site: position = -60 score = 7.89325 sequence = TTAGCACTCTCGATAAAAGAGTGCTAA Gene: PTD2_13624: Heat shock response RNA polymerase sigma factor RpoH (Sigma 32) |
Gene: OS145_02345: Heat shock response RNA polymerase sigma factor RpoH (Sigma 32) |
Gene: IL0229: Heat shock response RNA polymerase sigma factor RpoH (Sigma 32) |
Heat shock response RNA polymerase sigma factor RpoH (Sigma 32) |
Bluish color - the gene is in regulated operon. Different regulated operons are shown in different shades of blue.
Red color - the gene is in non-regulated operon.
Gray color - the orthologous gene is absent.
The star symbol - the TFBS is located in upstream region of this gene.
The number - the numeber of homologs (shown only if it is greater than one).
|
Regulated Genes | [ Tab delimited format ] | DOWNLOAD |
|
Regulatory Sites | [ FASTA format ] | DOWNLOAD |