Regulon of HrcA in Clostridium tetani E88

Properties
Regulator type:	Transcription factor
TF locus tag:	CTC02033
Regulator family:	HrcA
Regulation mode:	repressor
Biological process:	Heat shock response
Effector:	Heat shock
Regulog:	HrcA - Clostridia-1
Statistics of regulated genes:
- Genes	5
- Operons	2
Visualization:
	Allows to visualize regulon content in the context of metabolic pathways

Built upon 20 sites [see more]

Member of regulog collections

By taxonomy - Clostridia-1
By trascription factor - HrcA
By TF family - HrcA
By effector - Heat shock
By pathway - Heat shock response

Regulated operons
	Locus Tag	Name	Function
Position: -20 Score: 7.7 Sequence: TTAGCACTCAACAAGAGTGAGTGCTAA Locus tag: CTC02033 Name: hrcA Funciton: Heat-inducible transcription repressor HrcA Locus tag: CTC02032 Name: grpE Funciton: Heat shock protein GrpE Locus tag: CTC02031 Name: dnaK Funciton: Chaperone protein DnaK Locus tag: CTC02030 Name: dnaJ Funciton: Chaperone protein DnaJ
	CTC02033	hrcA	Heat-inducible transcription repressor HrcA
	CTC02032	grpE	Heat shock protein GrpE
	CTC02031	dnaK	Chaperone protein DnaK
	CTC02030	dnaJ	Chaperone protein DnaJ
Position: -71 Score: 6.9 Sequence: TTAGCACTCAGCAAATTGGAGTGCTAA Locus tag: CTC01489 Name: htpG Funciton: Chaperone protein HtpG
	CTC01489	htpG	Chaperone protein HtpG

Export
	Regulated Genes	[ Tab delimited format ]	DOWNLOAD
	Regulatory Sites	[ FASTA format ]	DOWNLOAD