Regulon of HrcA in Clostridium butyricum 5521

Properties
Regulator type:	Transcription factor
TF locus tag:	CBY_3533
Regulator family:	HrcA
Regulation mode:	repressor
Biological process:	Heat shock response
Effector:	Heat shock
Regulog:	HrcA - Clostridia-1
Statistics of regulated genes:
- Genes	6
- Operons	2
Visualization:
	Allows to visualize regulon content in the context of metabolic pathways

Built upon 20 sites [see more]

Member of regulog collections

By taxonomy - Clostridia-1
By trascription factor - HrcA
By TF family - HrcA
By effector - Heat shock
By pathway - Heat shock response

Regulated operons
	Locus Tag	Name	Function
Position: -44 Score: 7.6 Sequence: TTAGCACTCGCTGCTAATGAGTGCTAA Locus tag: CBY_3533 Name: hrcA Funciton: Heat-inducible transcription repressor HrcA Locus tag: CBY_3532 Name: grpE Funciton: Heat shock protein GrpE Locus tag: CBY_3531 Name: dnaK Funciton: Chaperone protein DnaK Locus tag: CBY_3530 Name: dnaJ Funciton: Chaperone protein DnaJ
	CBY_3533	hrcA	Heat-inducible transcription repressor HrcA
	CBY_3532	grpE	Heat shock protein GrpE
	CBY_3531	dnaK	Chaperone protein DnaK
	CBY_3530	dnaJ	Chaperone protein DnaJ
Position: -84 Score: 7.7 Sequence: TTAGCACTCGATGATGATGAGTGCTAA Locus tag: CBY_3050 Name: groES Funciton: Heat shock protein 60 family co-chaperone GroES Locus tag: CBY_3051 Name: groEL Funciton: Heat shock protein 60 family chaperone GroEL
	CBY_3050	groES	Heat shock protein 60 family co-chaperone GroES
	CBY_3051	groEL	Heat shock protein 60 family chaperone GroEL

Export
	Regulated Genes	[ Tab delimited format ]	DOWNLOAD
	Regulatory Sites	[ FASTA format ]	DOWNLOAD