Regulon of HrcA in Clostridium botulinum A str. ATCC 3502

Properties
Regulator type:	Transcription factor
TF locus tag:	CBO2961
Regulator family:	HrcA
Regulation mode:	repressor
Biological process:	Heat shock response
Effector:	Heat shock
Regulog:	HrcA - Clostridia-1
Statistics of regulated genes:
- Genes	7
- Operons	3
Visualization:
	Allows to visualize regulon content in the context of metabolic pathways

Built upon 20 sites [see more]

Member of regulog collections

By taxonomy - Clostridia-1
By trascription factor - HrcA
By TF family - HrcA
By effector - Heat shock
By pathway - Heat shock response

Regulated operons
	Locus Tag	Name	Function
Position: -84 Score: 8.1 Sequence: TTAGCACTCAATATTAATGAGTGCTAA Locus tag: CBO3299 Name: groES Funciton: Heat shock protein 60 family co-chaperone GroES Locus tag: CBO3298 Name: groEL Funciton: Heat shock protein 60 family chaperone GroEL
	CBO3299	groES	Heat shock protein 60 family co-chaperone GroES
	CBO3298	groEL	Heat shock protein 60 family chaperone GroEL
Position: -48 Score: 7.6 Sequence: TTAGCACTCGTTGCTAGTGAGTGCTAA Locus tag: CBO2961 Name: hrcA Funciton: Heat-inducible transcription repressor HrcA Locus tag: CBO2960 Name: grpE Funciton: Heat shock protein GrpE Locus tag: CBO2959 Name: dnaK Funciton: Chaperone protein DnaK Locus tag: CBO2958 Name: dnaJ Funciton: Chaperone protein DnaJ
	CBO2961	hrcA	Heat-inducible transcription repressor HrcA
	CBO2960	grpE	Heat shock protein GrpE
	CBO2959	dnaK	Chaperone protein DnaK
	CBO2958	dnaJ	Chaperone protein DnaJ
Position: -103 Score: 7 Sequence: TTAGCACTCACTAGCTTAAAGTGCTAA Locus tag: CBO1985 Name: htpG Funciton: Chaperone protein HtpG
	CBO1985	htpG	Chaperone protein HtpG

Export
	Regulated Genes	[ Tab delimited format ]	DOWNLOAD
	Regulatory Sites	[ FASTA format ]	DOWNLOAD