Regulon of HrcA in Clostridium beijerincki NCIMB 8052

Properties
Regulator type:	Transcription factor
TF locus tag:	Cbei_0828
Regulator family:	HrcA
Regulation mode:	repressor
Biological process:	Heat shock response
Effector:	Heat shock
Regulog:	HrcA - Clostridia-1
Statistics of regulated genes:
- Genes	6
- Operons	2
Visualization:
	Allows to visualize regulon content in the context of metabolic pathways

Built upon 20 sites [see more]

Member of regulog collections

By taxonomy - Clostridia-1
By trascription factor - HrcA
By TF family - HrcA
By effector - Heat shock
By pathway - Heat shock response

Regulated operons
	Locus Tag	Name	Function
Position: -44 Score: 7.6 Sequence: TTAGCACTCGAGGTTAATGAGTGCTAA Locus tag: Cbei_0828 Name: hrcA Funciton: Heat-inducible transcription repressor HrcA Locus tag: Cbei_0829 Name: grpE Funciton: Heat shock protein GrpE Locus tag: Cbei_0830 Name: dnaK Funciton: Chaperone protein DnaK Locus tag: Cbei_0831 Name: dnaJ Funciton: Chaperone protein DnaJ
	Cbei_0828	hrcA	Heat-inducible transcription repressor HrcA
	Cbei_0829	grpE	Heat shock protein GrpE
	Cbei_0830	dnaK	Chaperone protein DnaK
	Cbei_0831	dnaJ	Chaperone protein DnaJ
Position: -75 Score: 7.6 Sequence: TTAGCACTCGACAATGATGAGTGCTAA Locus tag: Cbei_0328 Name: groES Funciton: Heat shock protein 60 family co-chaperone GroES Locus tag: Cbei_0329 Name: groEL Funciton: Heat shock protein 60 family chaperone GroEL
	Cbei_0328	groES	Heat shock protein 60 family co-chaperone GroES
	Cbei_0329	groEL	Heat shock protein 60 family chaperone GroEL

Export
	Regulated Genes	[ Tab delimited format ]	DOWNLOAD
	Regulatory Sites	[ FASTA format ]	DOWNLOAD