Regulon of Zur in Clostridium tetani E88

Properties
Regulator type:	Transcription factor
TF locus tag:	CTC02363
Regulator family:	FUR
Regulation mode:	repressor
Biological process:	Zinc homeostasis
Effector:	Zinc ion, (Zn2+)
Regulog:	Zur - Clostridia-1
Statistics of regulated genes:
- Genes	8
- Operons	3
Visualization:
	Allows to visualize regulon content in the context of metabolic pathways

Built upon 46 sites [see more]

Member of regulog collections

By taxonomy - Clostridia-1
By trascription factor - Zur
By TF family - FUR
By effector - Zinc ion, (Zn2+)
By pathway - Zinc homeostasis

Regulated operons
	Locus Tag	Name	Function
Position: -34 Score: 6.8 Sequence: TAAATGCAAATCATTTGCATTTA Locus tag: CTC00941 Name: yciC Funciton: Putative metal chaperone, involved in Zn homeostasis, GTPase of COG0523 family Locus tag: CTC00940 Name: yciC2 Funciton: Putative metal chaperone, involved in Zn homeostasis, GTPase of COG0523 family Locus tag: CTC00939 Name: CAC1592 Funciton: ABC transporter, permease protein Locus tag: CTC00938 Name: CAC1591 Funciton: ABC transporter, substrate-binding protein
	CTC00941	yciC	Putative metal chaperone, involved in Zn homeostasis, GTPase of COG0523 family
	CTC00940	yciC2	Putative metal chaperone, involved in Zn homeostasis, GTPase of COG0523 family
	CTC00939	CAC1592	ABC transporter, permease protein
	CTC00938	CAC1591	ABC transporter, substrate-binding protein
Position: -105 Score: 5.9 Sequence: TACTTGCAAATAGTTTGCAATAT Position: -40 Score: 6.1 Sequence: TAAATGCAAACGATTTGCAAAAG Locus tag: CTC02360 Name: znuA Funciton: Zinc ABC transporter, periplasmic-binding protein ZnuA
	CTC02360	znuA	Zinc ABC transporter, periplasmic-binding protein ZnuA
Position: -103 Score: 6.1 Sequence: CTTTTGCAAATCGTTTGCATTTA Position: -89 Score: 4.9 Sequence: ATATTGAATAGCATTTGAAAATA Position: -38 Score: 5.9 Sequence: ATATTGCAAACTATTTGCAAGTA Locus tag: CTC02361 Name: znuC Funciton: Zinc ABC transporter, ATP-binding protein ZnuC Locus tag: CTC02362 Name: znuB Funciton: Zinc ABC transporter, inner membrane permease protein ZnuB Locus tag: CTC02363 Name: zur Funciton: Zinc homeostasis transcriptional regulator Zur, Fur family
	CTC02361	znuC	Zinc ABC transporter, ATP-binding protein ZnuC
	CTC02362	znuB	Zinc ABC transporter, inner membrane permease protein ZnuB
	CTC02363	zur	Zinc homeostasis transcriptional regulator Zur, Fur family

Export
	Regulated Genes	[ Tab delimited format ]	DOWNLOAD
	Regulatory Sites	[ FASTA format ]	DOWNLOAD