Regulon of Zur in Clostridium novyi NT

Properties
Regulator type:	Transcription factor
TF locus tag:	NT01CX_0363
Regulator family:	FUR
Regulation mode:	repressor
Biological process:	Zinc homeostasis
Effector:	Zinc ion, (Zn2+)
Regulog:	Zur - Clostridia-1
Statistics of regulated genes:
- Genes	9
- Operons	4
Visualization:
	Allows to visualize regulon content in the context of metabolic pathways

Built upon 46 sites [see more]

Member of regulog collections

By taxonomy - Clostridia-1
By trascription factor - Zur
By TF family - FUR
By effector - Zinc ion, (Zn2+)
By pathway - Zinc homeostasis

Regulated operons
	Locus Tag	Name	Function
Position: -57 Score: 6.3 Sequence: TTAGTGCAAATGATTTGCATTTG Locus tag: NT01CX_2391 Name: yciC Funciton: Putative metal chaperone, involved in Zn homeostasis, GTPase of COG0523 family Locus tag: NT01CX_2390 Name: yciC2 Funciton: Putative metal chaperone, involved in Zn homeostasis, GTPase of COG0523 family Locus tag: NT01CX_2389 Name: CAC1592 Funciton: ABC transporter, permease protein Locus tag: NT01CX_2388 Name: CAC1591 Funciton: ABC transporter, substrate-binding protein
	NT01CX_2391	yciC	Putative metal chaperone, involved in Zn homeostasis, GTPase of COG0523 family
	NT01CX_2390	yciC2	Putative metal chaperone, involved in Zn homeostasis, GTPase of COG0523 family
	NT01CX_2389	CAC1592	ABC transporter, permease protein
	NT01CX_2388	CAC1591	ABC transporter, substrate-binding protein
Position: -40 Score: 5.2 Sequence: AATATGAAAATGATAATCAATAT Position: -34 Score: 5.2 Sequence: AAAATGATAATCAATATCAATAA Locus tag: NT01CX_2337 Name: fld Funciton: Flavodoxin
	NT01CX_2337	fld	Flavodoxin
Position: -87 Score: 5.6 Sequence: TAAATGAATTTCATTTTCAATTG Locus tag: NT01CX_2431 Name: feoA Funciton: ferrous iron transport protein A Locus tag: NT01CX_2430 Name: feoA2 Funciton: Ferrous iron transport protein A Locus tag: NT01CX_2429 Name: feoB Funciton: Ferrous iron transport protein B
	NT01CX_2431	feoA	ferrous iron transport protein A
	NT01CX_2430	feoA2	Ferrous iron transport protein A
	NT01CX_2429	feoB	Ferrous iron transport protein B
Position: -175 Score: 5 Sequence: TATATGAAAAACATTGTCATTAT Position: -42 Score: 6.4 Sequence: TTTTTGCAAATGATTTGCATTTT Locus tag: NT01CX_0482 Name: znuA2 Funciton: Zinc ABC transporter, periplasmic-binding protein ZnuA
	NT01CX_0482	znuA2	Zinc ABC transporter, periplasmic-binding protein ZnuA

Export
	Regulated Genes	[ Tab delimited format ]	DOWNLOAD
	Regulatory Sites	[ FASTA format ]	DOWNLOAD