Regulon of Zur in Clostridium kluyveri DSM 555

Properties
Regulator type:	Transcription factor
TF locus tag:	CKL_3342
Regulator family:	FUR
Regulation mode:	repressor
Biological process:	Zinc homeostasis
Effector:	Zinc ion, (Zn2+)
Regulog:	Zur - Clostridia-1
Statistics of regulated genes:
- Genes	9
- Operons	5
Visualization:
	Allows to visualize regulon content in the context of metabolic pathways

Built upon 46 sites [see more]

Member of regulog collections

By taxonomy - Clostridia-1
By trascription factor - Zur
By TF family - FUR
By effector - Zinc ion, (Zn2+)
By pathway - Zinc homeostasis

Regulated operons
	Locus Tag	Name	Function
Position: -53 Score: 5.9 Sequence: TAGATGCAAACCATTTGCATCTA Locus tag: CKL_3051 Name: znuA Funciton: Zinc ABC transporter, periplasmic-binding protein ZnuA
	CKL_3051	znuA	Zinc ABC transporter, periplasmic-binding protein ZnuA
Position: -79 Score: 6.4 Sequence: TAAATGCTAATAATTTGCATTTA Locus tag: CKL_2453 Name: yciC Funciton: Putative metal chaperone, involved in Zn homeostasis, GTPase of COG0523 family Locus tag: CKL_2452 Name: CAC1592 Funciton: ABC transporter, permease protein Locus tag: CKL_2451 Name: CAC1591 Funciton: ABC transporter, substrate-binding protein
	CKL_2453	yciC	Putative metal chaperone, involved in Zn homeostasis, GTPase of COG0523 family
	CKL_2452	CAC1592	ABC transporter, permease protein
	CKL_2451	CAC1591	ABC transporter, substrate-binding protein
Position: -112 Score: 5.8 Sequence: TATTTGCAAATCACTTGCAACTA Locus tag: CKL_2905 Name: znuC Funciton: Zinc ABC transporter, ATP-binding protein ZnuC Locus tag: CKL_2906 Name: znuB Funciton: Zinc ABC transporter, inner membrane permease protein ZnuB
	CKL_2905	znuC	Zinc ABC transporter, ATP-binding protein ZnuC
	CKL_2906	znuB	Zinc ABC transporter, inner membrane permease protein ZnuB
Position: -152 Score: 5.8 Sequence: ATATTGAACATCATTTTCAATTA Locus tag: CKL_2190 Name: rpsD2 Funciton: SSU ribosomal protein S4p paralog
	CKL_2190	rpsD2	SSU ribosomal protein S4p paralog
Position: -56 Score: 5.7 Sequence: TATATGATAATGATTTTCATTAT Locus tag: CKL_2165 Name: fld Funciton: Flavodoxin Locus tag: CKL_2164 Name: CAC0588 Funciton: conserved hypothetical protein
	CKL_2165	fld	Flavodoxin
	CKL_2164	CAC0588	conserved hypothetical protein

Export
	Regulated Genes	[ Tab delimited format ]	DOWNLOAD
	Regulatory Sites	[ FASTA format ]	DOWNLOAD