Regulon of Zur in Clostridium butyricum 5521

Properties
Regulator type:	Transcription factor
TF locus tag:	CBY_0017
Regulator family:	FUR
Regulation mode:	repressor
Biological process:	Zinc homeostasis
Effector:	Zinc ion, (Zn2+)
Regulog:	Zur - Clostridia-1
Statistics of regulated genes:
- Genes	5
- Operons	4
Visualization:
	Allows to visualize regulon content in the context of metabolic pathways

Built upon 46 sites [see more]

Member of regulog collections

By taxonomy - Clostridia-1
By trascription factor - Zur
By TF family - FUR
By effector - Zinc ion, (Zn2+)
By pathway - Zinc homeostasis

Regulated operons
	Locus Tag	Name	Function
Position: -128 Score: 6 Sequence: ATATTGCAAATCATTTGCAGATA Locus tag: CBY_3660 Name: znuC Funciton: Zinc ABC transporter, ATP-binding protein ZnuC Locus tag: CBY_3661 Name: znuB Funciton: Zinc ABC transporter, inner membrane permease protein ZnuB
	CBY_3660	znuC	Zinc ABC transporter, ATP-binding protein ZnuC
	CBY_3661	znuB	Zinc ABC transporter, inner membrane permease protein ZnuB
Position: -33 Score: 5.9 Sequence: CAAATGCAAATCATATGCAAAAT Locus tag: CBY_3975 Name: znuA Funciton: Zinc ABC transporter, periplasmic-binding protein ZnuA
	CBY_3975	znuA	Zinc ABC transporter, periplasmic-binding protein ZnuA
Position: -101 Score: 5.6 Sequence: AAAATGATAATGAATTTCATTTA Position: -95 Score: 5.1 Sequence: ATAATGAATTTCATTTACATTTA Locus tag: CBY_3339 Name: rpsD2 Funciton: SSU ribosomal protein S4p paralog
	CBY_3339	rpsD2	SSU ribosomal protein S4p paralog
Position: -88 Score: 6.4 Sequence: ATATTGAAAATTATTTGCATTTA Locus tag: CBY_1468 Name: feoA Funciton: ferrous iron transport protein A
	CBY_1468	feoA	ferrous iron transport protein A

Export
	Regulated Genes	[ Tab delimited format ]	DOWNLOAD
	Regulatory Sites	[ FASTA format ]	DOWNLOAD