Regulon of Zur in Clostridium botulinum A str. ATCC 3502

Properties
Regulator type:	Transcription factor
TF locus tag:	CBO3220
Regulator family:	FUR
Regulation mode:	repressor
Biological process:	Zinc homeostasis
Effector:	Zinc ion, (Zn2+)
Regulog:	Zur - Clostridia-1
Statistics of regulated genes:
- Genes	6
- Operons	4
Visualization:
	Allows to visualize regulon content in the context of metabolic pathways

Built upon 46 sites [see more]

Member of regulog collections

By taxonomy - Clostridia-1
By trascription factor - Zur
By TF family - FUR
By effector - Zinc ion, (Zn2+)
By pathway - Zinc homeostasis

Regulated operons
	Locus Tag	Name	Function
Position: -86 Score: 6.4 Sequence: TAAATGCAAATAGTTTGCAATAA Locus tag: CBO1363 Name: znuA Funciton: Zinc ABC transporter, periplasmic-binding protein ZnuA
	CBO1363	znuA	Zinc ABC transporter, periplasmic-binding protein ZnuA
Position: -157 Score: 6.4 Sequence: TTATTGCAAACTATTTGCATTTA Locus tag: CBO1362 Name: znuC Funciton: Zinc ABC transporter, ATP-binding protein ZnuC Locus tag: CBO1361 Name: znuB Funciton: Zinc ABC transporter, inner membrane permease protein ZnuB
	CBO1362	znuC	Zinc ABC transporter, ATP-binding protein ZnuC
	CBO1361	znuB	Zinc ABC transporter, inner membrane permease protein ZnuB
Position: -92 Score: 5.8 Sequence: ATATTGAAAATCATTTTCAGTTT Locus tag: CBO3405 Name: rpsD2 Funciton: SSU ribosomal protein S4p paralog
	CBO3405	rpsD2	SSU ribosomal protein S4p paralog
Position: -78 Score: 5.2 Sequence: TAAATGAAATTGATTCTCACTTT Locus tag: CBO0346 Name: fld Funciton: Flavodoxin Locus tag: CBO0347 Name: CAC0588 Funciton: conserved hypothetical protein
	CBO0346	fld	Flavodoxin
	CBO0347	CAC0588	conserved hypothetical protein

Export
	Regulated Genes	[ Tab delimited format ]	DOWNLOAD
	Regulatory Sites	[ FASTA format ]	DOWNLOAD