Regulon of FlpA in Pediococcus pentosaceus ATCC 25745

Properties
Regulator type:	Transcription factor
TF locus tag:	PEPE_0408
Regulator family:	CRP
Regulation mode:	activator (repressor)
Biological process:	Heavy metal resistance
Effector:	Oxygen
Regulog:	FlpA - Lactobacillaceae
Statistics of regulated genes:
- Genes	4
- Operons	2
Visualization:
	Allows to visualize regulon content in the context of metabolic pathways

Built upon 32 sites [see more]

Member of regulog collections

By taxonomy - Lactobacillaceae
By TF family - CRP
By effector - Oxygen
By pathway - Heavy metal resistance

Regulated operons
	Locus Tag	Name	Function
Position: -74 Score: 5.7 Sequence: AAATTGACGTAGGTCAATTT Locus tag: PEPE_0408 Name: flpA Funciton: Heavy metal resistance transcriptional regulator FlpA, Crp family
	PEPE_0408	flpA	Heavy metal resistance transcriptional regulator FlpA, Crp family
Position: -75 Score: 5.7 Sequence: AAATTGACCTACGTCAATTT Locus tag: PEPE_0409 Name: copZ Funciton: Copper chaperone Locus tag: PEPE_0410 Name: dps Funciton: Non-specific DNA-binding protein Dps / Iron-binding ferritin-like antioxidant protein / Ferroxidase (EC 1.16.3.1) Locus tag: PEPE_0411 Name: cadA Funciton: Lead, cadmium, zinc and mercury transporting ATPase (EC:3.6.3.-)
	PEPE_0409	copZ	Copper chaperone
	PEPE_0410	dps	Non-specific DNA-binding protein Dps / Iron-binding ferritin-like antioxidant protein / Ferroxidase (EC 1.16.3.1)
	PEPE_0411	cadA	Lead, cadmium, zinc and mercury transporting ATPase (EC:3.6.3.-)

Export
	Regulated Genes	[ Tab delimited format ]	DOWNLOAD
	Regulatory Sites	[ FASTA format ]	DOWNLOAD