Regulon of FlpA in Leuconostoc mesenteroides subsp. mesenteroides ATCC 8293

Properties
Regulator type:	Transcription factor
TF locus tag:	LEUM_2066, LEUM_A06
Regulator family:	CRP
Regulation mode:	activator (repressor)
Biological process:	Heavy metal resistance
Effector:	Oxygen
Regulog:	FlpA - Lactobacillaceae
Statistics of regulated genes:
- Genes	4
- Operons	2
Visualization:
	Allows to visualize regulon content in the context of metabolic pathways

Built upon 32 sites [see more]

Member of regulog collections

By taxonomy - Lactobacillaceae
By TF family - CRP
By effector - Oxygen
By pathway - Heavy metal resistance

Regulated operons
	Locus Tag	Name	Function
Position: -66 Score: 5.2 Sequence: TAATTGATCTATATCAAGTA Locus tag: LEUM_A04 Name: copZ Funciton: Copper chaperone Locus tag: LEUM_A05 Name: dps Funciton: Non-specific DNA-binding protein Dps / Iron-binding ferritin-like antioxidant protein / Ferroxidase (EC 1.16.3.1) Locus tag: LEUM_A06 Name: flpA Funciton: Heavy metal resistance transcriptional regulator FlpA, Crp family
	LEUM_A04	copZ	Copper chaperone
	LEUM_A05	dps	Non-specific DNA-binding protein Dps / Iron-binding ferritin-like antioxidant protein / Ferroxidase (EC 1.16.3.1)
	LEUM_A06	flpA	Heavy metal resistance transcriptional regulator FlpA, Crp family
Position: -76 Score: 6.3 Sequence: AACTTGATGGACGTCAAGTT Locus tag: LEUM_A03 Name: cadA Funciton: Lead, cadmium, zinc and mercury transporting ATPase (EC:3.6.3.-)
	LEUM_A03	cadA	Lead, cadmium, zinc and mercury transporting ATPase (EC:3.6.3.-)

Export
	Regulated Genes	[ Tab delimited format ]	DOWNLOAD
	Regulatory Sites	[ FASTA format ]	DOWNLOAD