Regulon of FlpA in Lactobacillus salivarius subsp. salivarius UCC118

Properties
Regulator type:	Transcription factor
TF locus tag:	LSL_1782
Regulator family:	CRP
Regulation mode:	activator (repressor)
Biological process:	Heavy metal resistance
Effector:	Oxygen
Regulog:	FlpA - Lactobacillaceae
Statistics of regulated genes:
- Genes	4
- Operons	4
Visualization:
	Allows to visualize regulon content in the context of metabolic pathways

Built upon 32 sites [see more]

Member of regulog collections

By taxonomy - Lactobacillaceae
By TF family - CRP
By effector - Oxygen
By pathway - Heavy metal resistance

Regulated operons
	Locus Tag	Name	Function
Position: -210 Score: 5.6 Sequence: AACTTGATAGCCATAAATTT Position: -88 Score: 5.7 Sequence: AACTTGATGTCAGTCAATTA Locus tag: LSL_1786 Name: cadA Funciton: Lead, cadmium, zinc and mercury transporting ATPase (EC:3.6.3.-)
	LSL_1786	cadA	Lead, cadmium, zinc and mercury transporting ATPase (EC:3.6.3.-)
Position: -129 Score: 5.9 Sequence: AACTTGATATGCGTCAATTT Locus tag: LSL_1784 Name: copZ Funciton: Copper chaperone
	LSL_1784	copZ	Copper chaperone
Position: -89 Score: 5.6 Sequence: TTCTTGATGTGCATCAATTT Locus tag: LSL_1782 Name: flpA Funciton: Heavy metal resistance transcriptional regulator FlpA, Crp family
	LSL_1782	flpA	Heavy metal resistance transcriptional regulator FlpA, Crp family
Position: -118 Score: 5.5 Sequence: TTCTTGATGAGCGTCAATTT Locus tag: LSL_1781 Name: dps Funciton: Non-specific DNA-binding protein Dps / Iron-binding ferritin-like antioxidant protein / Ferroxidase (EC 1.16.3.1)
	LSL_1781	dps	Non-specific DNA-binding protein Dps / Iron-binding ferritin-like antioxidant protein / Ferroxidase (EC 1.16.3.1)

Export
	Regulated Genes	[ Tab delimited format ]	DOWNLOAD
	Regulatory Sites	[ FASTA format ]	DOWNLOAD