Regulon of FlpA in Lactobacillus reuteri JCM 1112

Properties
Regulator type:	Transcription factor
TF locus tag:	LAR_1338
Regulator family:	CRP
Regulation mode:	activator (repressor)
Biological process:	Heavy metal resistance
Effector:	Oxygen
Regulog:	FlpA - Lactobacillaceae
Statistics of regulated genes:
- Genes	3
- Operons	2
Visualization:
	Allows to visualize regulon content in the context of metabolic pathways

Built upon 32 sites [see more]

Member of regulog collections

By taxonomy - Lactobacillaceae
By TF family - CRP
By effector - Oxygen
By pathway - Heavy metal resistance

Regulated operons
	Locus Tag	Name	Function
Position: -69 Score: 5.7 Sequence: AAATTGATGATAATCAATTT Locus tag: LAR_1340 Name: copZ Funciton: Copper chaperone
	LAR_1340	copZ	Copper chaperone
Position: -298 Score: 5.7 Sequence: AAATTGATGATAATCAATTT Locus tag: LAR_1339 Name: dps Funciton: Non-specific DNA-binding protein Dps / Iron-binding ferritin-like antioxidant protein / Ferroxidase (EC 1.16.3.1) Locus tag: LAR_1338 Name: flpA Funciton: Heavy metal resistance transcriptional regulator FlpA, Crp family
	LAR_1339	dps	Non-specific DNA-binding protein Dps / Iron-binding ferritin-like antioxidant protein / Ferroxidase (EC 1.16.3.1)
	LAR_1338	flpA	Heavy metal resistance transcriptional regulator FlpA, Crp family

Export
	Regulated Genes	[ Tab delimited format ]	DOWNLOAD
	Regulatory Sites	[ FASTA format ]	DOWNLOAD