Regulon of FlpA in Lactobacillus fermentum IFO 3956

Properties
Regulator type:	Transcription factor
TF locus tag:	LAF_1699, LAF_1464
Regulator family:	CRP
Regulation mode:	activator (repressor)
Biological process:	Heavy metal resistance
Effector:	Oxygen
Regulog:	FlpA - Lactobacillaceae
Statistics of regulated genes:
- Genes	7
- Operons	4
Visualization:
	Allows to visualize regulon content in the context of metabolic pathways

Built upon 32 sites [see more]

Member of regulog collections

By taxonomy - Lactobacillaceae
By TF family - CRP
By effector - Oxygen
By pathway - Heavy metal resistance

Regulated operons
	Locus Tag	Name	Function
Position: -91 Score: 4.8 Sequence: AAGTTGATAGAAAACAATTT Locus tag: LAF_1466 Name: copZ Funciton: Copper chaperone Locus tag: LAF_1465 Name: LAF_1465 Funciton: Hypothetical protein Locus tag: LAF_1464 Name: flpA Funciton: Heavy metal resistance transcriptional regulator FlpA, Crp family
	LAF_1466	copZ	Copper chaperone
	LAF_1465	LAF_1465	Hypothetical protein
	LAF_1464	flpA	Heavy metal resistance transcriptional regulator FlpA, Crp family
Position: -69 Score: 5.2 Sequence: CTCTTGATTCCGATCAATTT Locus tag: LAF_1702 Name: cadA Funciton: Lead, cadmium, zinc and mercury transporting ATPase (EC:3.6.3.-)
	LAF_1702	cadA	Lead, cadmium, zinc and mercury transporting ATPase (EC:3.6.3.-)
Position: -68 Score: 5.1 Sequence: AAGTTGATGAGGATCAATTA Locus tag: LAF_1701 Name: copZ Funciton: Copper chaperone
	LAF_1701	copZ	Copper chaperone
Position: -298 Score: 5.1 Sequence: AAGTTGATGAGGATCAATTA Locus tag: LAF_1700 Name: dps Funciton: Non-specific DNA-binding protein Dps / Iron-binding ferritin-like antioxidant protein / Ferroxidase (EC 1.16.3.1) Locus tag: LAF_1699 Name: flpA Funciton: Heavy metal resistance transcriptional regulator FlpA, Crp family
	LAF_1700	dps	Non-specific DNA-binding protein Dps / Iron-binding ferritin-like antioxidant protein / Ferroxidase (EC 1.16.3.1)
	LAF_1699	flpA	Heavy metal resistance transcriptional regulator FlpA, Crp family

Export
	Regulated Genes	[ Tab delimited format ]	DOWNLOAD
	Regulatory Sites	[ FASTA format ]	DOWNLOAD