Regulon of FlpA in Lactobacillus delbrueckii subsp. bulgaricus ATCC BAA-365

Properties
Regulator type:	Transcription factor
TF locus tag:	LBUL_0159, LBUL_0430
Regulator family:	CRP
Regulation mode:	activator (repressor)
Biological process:	Heavy metal resistance
Effector:	Oxygen
Regulog:	FlpA - Lactobacillaceae
Statistics of regulated genes:
- Genes	2
- Operons	1
Visualization:
	Allows to visualize regulon content in the context of metabolic pathways

Built upon 32 sites [see more]

Member of regulog collections

By taxonomy - Lactobacillaceae
By TF family - CRP
By effector - Oxygen
By pathway - Heavy metal resistance

Regulated operons
	Locus Tag	Name	Function
Position: -77 Score: 5.3 Sequence: ATCTTGATAGAAATCAATTG Locus tag: LBUL_0427 Name: cadA Funciton: Lead, cadmium, zinc and mercury transporting ATPase (EC:3.6.3.-) Locus tag: LBUL_0428 Name: copZ Funciton: Copper chaperone
	LBUL_0427	cadA	Lead, cadmium, zinc and mercury transporting ATPase (EC:3.6.3.-)
	LBUL_0428	copZ	Copper chaperone

Export
	Regulated Genes	[ Tab delimited format ]	DOWNLOAD
	Regulatory Sites	[ FASTA format ]	DOWNLOAD