Regulon of FlpA in Lactobacillus casei ATCC 334

Properties
Regulator type:	Transcription factor
TF locus tag:	LSEI_0073
Regulator family:	CRP
Regulation mode:	activator (repressor)
Biological process:	Heavy metal resistance
Effector:	Oxygen
Regulog:	FlpA - Lactobacillaceae
Statistics of regulated genes:
- Genes	4
- Operons	2
Visualization:
	Allows to visualize regulon content in the context of metabolic pathways

Built upon 32 sites [see more]

Member of regulog collections

By taxonomy - Lactobacillaceae
By TF family - CRP
By effector - Oxygen
By pathway - Heavy metal resistance

Regulated operons
	Locus Tag	Name	Function
Position: -76 Score: 5.4 Sequence: AACTTGACGACGATCAAGGA Locus tag: LSEI_0071 Name: copZ Funciton: Copper chaperone Locus tag: LSEI_0072 Name: dps Funciton: Non-specific DNA-binding protein Dps / Iron-binding ferritin-like antioxidant protein / Ferroxidase (EC 1.16.3.1) Locus tag: LSEI_0073 Name: flpA Funciton: Heavy metal resistance transcriptional regulator FlpA, Crp family
	LSEI_0071	copZ	Copper chaperone
	LSEI_0072	dps	Non-specific DNA-binding protein Dps / Iron-binding ferritin-like antioxidant protein / Ferroxidase (EC 1.16.3.1)
	LSEI_0073	flpA	Heavy metal resistance transcriptional regulator FlpA, Crp family
Position: -68 Score: 4.8 Sequence: AAGTTGATCACCGTCAAGGC Locus tag: LSEI_0070 Name: cadA Funciton: Lead, cadmium, zinc and mercury transporting ATPase (EC:3.6.3.-)
	LSEI_0070	cadA	Lead, cadmium, zinc and mercury transporting ATPase (EC:3.6.3.-)

Export
	Regulated Genes	[ Tab delimited format ]	DOWNLOAD
	Regulatory Sites	[ FASTA format ]	DOWNLOAD