Regulon of UxuR in Lactobacillus brevis ATCC 367

Properties
Regulator type:	Transcription factor
TF locus tag:	LVIS_0145
Regulator family:	GntR/Others
Regulation mode:	repressor
Biological process:	Glucuronate utilization; Galacturonate utilization
Effector:
Regulog:	UxuR - Lactobacillaceae
Statistics of regulated genes:
- Genes	8
- Operons	3
Visualization:
	Allows to visualize regulon content in the context of metabolic pathways

Built upon 3 sites [see more]

Member of regulog collections

By taxonomy - Lactobacillaceae
By TF family - GntR/Others
By pathway - Glucuronate utilization
By pathway - Galacturonate utilization

Regulated operons
	Locus Tag	Name	Function
Position: -119 Score: 6.7 Sequence: ATAGCTTATATATCAGTTTT Locus tag: LVIS_0136 Name: uidB Funciton: Predicted oligogalacturonide transporter Locus tag: LVIS_0135 Name: uxaC Funciton: Uronate isomerase (EC 5.3.1.12)
	LVIS_0136	uidB	Predicted oligogalacturonide transporter
	LVIS_0135	uxaC	Uronate isomerase (EC 5.3.1.12)
Position: -259 Score: 6.7 Sequence: AAAACTGATATATAAGCTAT Locus tag: LVIS_0137 Name: aglX Funciton: Alpha-glucosidase, predicted Locus tag: LVIS_0138 Name: bglX Funciton: Beta-galactosidase/glucuronidase
	LVIS_0137	aglX	Alpha-glucosidase, predicted
	LVIS_0138	bglX	Beta-galactosidase/glucuronidase
Position: -86 Score: 6.6 Sequence: AATACTGATATATAAGTTAT Locus tag: LVIS_0139 Name: uxuB Funciton: D-mannonate oxidoreductase (EC 1.1.1.57) Locus tag: LVIS_0140 Name: yqhA Funciton: Predicted aldose epimerase Locus tag: LVIS_0141 Name: pgmX Funciton: Predicted phosphoglycerate mutase Locus tag: LVIS_0142 Name: pgdH Funciton: Predicted 3-phosphoglycerate dehydrogenase
	LVIS_0139	uxuB	D-mannonate oxidoreductase (EC 1.1.1.57)
	LVIS_0140	yqhA	Predicted aldose epimerase
	LVIS_0141	pgmX	Predicted phosphoglycerate mutase
	LVIS_0142	pgdH	Predicted 3-phosphoglycerate dehydrogenase

Export
	Regulated Genes	[ Tab delimited format ]	DOWNLOAD
	Regulatory Sites	[ FASTA format ]	DOWNLOAD